|
the Massachusetts General Hospital Cancer Center and Department of Pathology, Harvard Medical School, Charlestown, MA Vanderbilt-Ingram Cancer Center, Nashville, TN Free University Hospital, Amsterdam, the Netherlands The University of Texas M.D. Anderson Cancer Center, Houston, TX Heidelberg University Medical Centre, Mannheim, Germany Kinki University School of Medicine, Osaka, Japan Memorial Sloan-Kettering Cancer Center, New York, NY Vall d'Hebron University Hospital, Barcelona, Spain AstraZeneca Pharmaceuticals, Wilmington, DE
ABSTRACT
PURPOSE: Most cases of non–small-cell lung cancer (NSCLC) with dramatic responses to gefitinib have specific activating mutations in the epidermal growth factor receptor (EGFR), but the predictive value of these mutations has not been defined in large clinical trials. The goal of this study was to determine the contribution of molecular alterations in EGFR to response and survival within the phase II (IDEAL) and phase III (INTACT) trials of gefitinib.
PATIENTS AND METHODS: We analyzed the frequency of EGFR mutations in lung cancer specimens from both the IDEAL and INTACT trials and compared it with EGFR gene amplification, another genetic abnormality in NSCLC.
RESULTS: EGFR mutations correlated with previously identified clinical features of gefitinib response, including adenocarcinoma histology, absence of smoking history, female sex, and Asian ethnicity. No such association was seen in patients whose tumors had EGFR amplification, suggesting that these molecular markers identify different biologic subsets of NSCLC. In the IDEAL trials, responses to gefitinib were seen in six of 13 tumors (46%) with an EGFR mutation, two of seven tumors (29%) with amplification, and five of 56 tumors (9%) with neither mutation nor amplification (P = .001 for either EGFR mutation or amplification v neither abnormality). Analysis of the INTACT trials did not show a statistically significant difference in response to gefitinib plus chemotherapy according to EGFR genotype.
CONCLUSION: EGFR mutations and, to a lesser extent, amplification appear to identify distinct subsets of NSCLC with an increased response to gefitinib. The combination of gefitinib with chemotherapy does not improve survival in patients with these molecular markers.
INTRODUCTION
Lung cancer remains the highest cause of cancer-related mortality in the United States and Western Europe, and while transient responses to aggressive chemotherapy are observed in approximately 30% of patients, the impact on patient survival has been modest.1 The success of imatinib (Gleevec; Novartis, Basel, Switzerland) in the treatment of chronic myeloid leukemia and gastrointestinal stromal tumor has provided compelling evidence for the effectiveness of tyrosine kinase inhibitors in the treatment of some types of cancer.2-4 Imatinib targets the kinase pocket of ABL, which is activated by the characteristic BCR-ABL translocation of CML, and that of C-KIT, which is activated by mutations in gastrointestinal stromal tumors. In these and in a few other tumor types, the dramatic effect of imatinib is thought to result from its targeting a critical genetic lesion on which tumor cells have become dependent for their survival, so-called oncogene addiction.5
Extrapolation of these therapeutic approaches to common epithelial cancers has been limited by the absence of comparable insight about critical genetic lesions. Small molecule kinase inhibitors have been developed against growth factor receptors frequently expressed in epithelial cancers, the first of which, gefitinib (Iressa; AstraZeneca, Wilmington, DE), targets the epidermal growth factor receptor (EGFR).6 Gefitinib was tested in chemotherapy-refractory non–small-cell lung cancer (NSCLC) patients, on the basis of their frequent expression of EGFR and their poor response to standard therapies. A phase II trial of two doses of gefitinib monotherapy in refractory NSCLC in the United States reported an overall 10% partial response (PR) rate (IDEAL-2), with a 19% PR observed in a companion European/Japanese study (IDEAL-1).7,8 Two subsequent phase III trials randomized previously untreated patients with advanced NSCLC to standard platinum-based chemotherapy, with or without the addition of gefitinib at two doses (INTACT-1, cisplatin and gemcitabine ± gefitinib; INTACT-2, carboplatin and paclitaxel ± gefitinib).9,10 These trials reported no difference in response rate, time to progression (TTP), or 1-year or overall survival (OS) with the addition of gefitinib to standard chemotherapy. These findings were nearly identical to the results of the TALENT and TRIBUTE studies of similar design to INTACT but using the EGFR-tyrosine kinase inhibitor (TKI), erlotinib.11,12 Thus, despite randomized clinical studies involving nearly 4,000 patients with advanced disease there was no discernable improvement in outcome following the addition of EGFR-TKI to standard cytotoxic chemotherapy.
While initial trials of gefitinib failed to show activity in most cases of NSCLC, a subset of cases that did respond had rapid and dramatic tumor shrinkage. These responses were more common in women, East Asians, and in nonsmokers, and their tumors were primarily adenocarcinomas, often with areas of bronchoalveolar histology. Expression levels of EGFR did not correlate with gefitinib response in the IDEAL trials.13 We, and others, have recently reported that the majority of tumors with dramatic responses harbor mutations in the EGFR kinase domain that were not found in nonresponsive cases.14-16 These mutations were detected in approximately 10% of NSCLC cases in North America and 30% of patients in Asia.14-28 EGFR mutations associated with gefitinib response include amino acid substitutions and in-frame deletions clustered around the ATP binding pocket, which also serves as the drug binding site. A small number of different mutations account for most cases, suggesting that they confer specific enzymatic properties. Indeed, reconstitution of these mutations in vitro reveals that they mediate dramatically increased antiapoptotic signals following binding of the EGF ligand to the receptor, compared with wild-type EGFR.29-31 Suppression of these survival signals, either by gefitinib or by direct targeting of the mutant EGFR transcript using small interfering RNA, leads to rapid apoptosis, consistent with the oncogene addiction model.29
Studies linking EGFR mutations to gefitinib response have involved retrospective analysis of patients with dramatic responses to the drug. To obtain a more comprehensive view of the molecular determinants of gefitinib response, analysis of unselected specimens from large clinical trials is essential. We describe here a molecular analysis of EGFR in tumor specimens collected within the IDEAL and INTACT trials, to gain further insight into the clinical responses associated with gefitinib treatment of NSCLC.
PATIENTS AND METHODS
Clinical Material
The IDEAL-1 and IDEAL-2 studies of gefitinib monotherapy (250 mg/d and 500 mg/d, respectively) in advanced NSCLC patients, who had received prior chemotherapy, enrolled 425 patients. Tumor samples were not mandatory and were obtained at the time of randomization or up to several years before study entry. Paraffin-embedded tumor blocks were available from 155 patients for analysis of EGFR mutation and gene amplification. The INTACT-1 and INTACT-2 studies comparing chemotherapy to chemotherapy plus gefitinib (250 mg/d or 500 mg/d, respectively) in previously untreated NSCLC enrolled 2,130 patients. Paraffin-embedded diagnostic tumor blocks were available from 666 patients for analysis of EGFR gene sequence and amplification.
DNA Extraction and EGFR sequencing
Hematoxylin and eosin-stained sections of formalin-fixed paraffin-embedded tissue were reviewed by a pathologist to identify regions of tissue comprising at least 50% tumor cells. Cases where tumor cells comprised less than 50% of the tissue, or where the amount of tumor tissue was limited, were excluded from further analysis (36 IDEAL cases and 142 INTACT cases). Genomic DNA was isolated using the Gentra purification system according to the manufacturer's instructions. Polymerase chain reaction (PCR) conditions for the amplification of EGFR are available on request.
PCR amplification of p53, Kras, and PTEN
Exons 1 and 2 of Kras, exons 5 to 8 of p53, and exons 1 to 9 of PTEN were amplified from all available patients determined to have an EGFR mutation. Primers and PCR conditions are available on request.
Mutational Analysis
PCR amplicons generated from specimens collected within the IDEAL and INTACT trials were purified using exonuclease I (United States Biochemical, Cleveland, OH) and shrimp alkaline phosphatase (United States Biochemical, Cleveland, OH) followed by dilution in water before sequencing. Bidirectional capillary sequencing was performed using BigDye Terminator v1.1 chemistry (Applied Biosystems, Foster City, CA) in combination with an ABI3100 instrument. Electropherograms were aligned and reviewed using Sequence Navigator software (Applied Biosystems). All mutations were confirmed by analysis of at least two independent PCR amplifications.
Quantative Real-Time PCR
EGFR copy number was determined by TaqMan real-time quantitative PCR with TaqMan Universal PCR mastermix and an ABI Prism 7900HT sequence detection system (Applied Biosystems, Foster City CA). The primers (5'-3') and fluorogenic probe used for EGFR were CAATTGCCAGTTAACGTCTTCCTT (sense primer), TTTCTCACCTTCTGGGATCCA (antisense primer), and TCTCTCTGTCATAGGGAC (probe). For the control gene on chromosome 4, PCDH7, these were GCTGCAATCTCCTCCCTGAA (sense primer), TGCCTTTTCTCACCTGCATTC (antisense primer), and CCACTGCTCCGACATG (probe). For COG5, a control gene located on chromosome 7, primers and probe were TGGAAGATGATGCACAAGATATATTCA (sense primer), CCAACTAACAGGTCAAATTAAACAAACA (antisense primer), and CCAAAAAAGCCAGATTATGA (probe), respectively.
RESULTS
Molecular Characterization of EGFR in Specimens From IDEAL and INTACT Trials
All available tumor specimens (n = 821) from the IDEAL-1, IDEAL-2, INTACT-1, and INTACT-2 studies were subjected to analysis. Pathology review of paraffin-embedded sections was performed for all of these cases, and tumors were considered adequate for analysis if microdissection resulted in more than 50% tumor cell content (n = 643). Nucleotide sequencing of the kinase domain of EGFR (exons 18 to 21) was performed using nested PCR amplification of individual exons. The unequal signal observed for genetic variants in some cases raised the possibility of selective allelic amplification, which was confirmed using quantitative real-time PCR analysis. For IDEAL-1 and IDEAL-2, 119 tumor samples were available for molecular analysis, representing 28% of all cases entered in the trials. Of these, 79 samples (66%) were successfully sequenced and 90 samples (76%) were successfully subjected to amplification analysis. For INTACT-1 and INTACT-2, 524 samples were retrieved for analysis from 2,130 clinical cases (25%), of which 312 samples (59%) were successfully sequenced and 453 samples (86%) had successful gene copy number quantification. Objective responses (OR, including partial or complete responses) to gefitinib were achieved in 15% of cases (12 out of 79) from the IDEAL trials for which tumor material was analyzed, consistent with the 10% to 19% OR previously reported for the clinical cohorts. For the INTACT cases available for molecular analysis, the OR to chemotherapy alone and chemotherapy plus gefitinib was 40% and 57%, respectively, compared with 29% to 45% and 30% to 50% reported for the entire cohort in the clinical trials. The specimens analyzed were, therefore, representative of the clinical studies as represented by a comparison of demographic factors between the populations with assessable sample to the overall trial populations (Tables 1 and 2) .
EGFR mutations were found in 14 out of 79 cases (18%) from the IDEAL studies (Table 3). These included overlapping in-frame deletions within exon 19 (n = 11), representing four distinct nucleotide deletions encompassing the LREA (LeuArgGluAla) motif within the kinase domain; the recurrent L858R missense mutation in exon 21 (two cases); and a novel insertion of a single amino acid residue within exon 20 (n = 1). For the INTACT studies, EGFR mutations were detected in 32 out of 312 cases (10%), with comparable distribution among the three treatment arms as well as among the different chemotherapy regimens used in the two INTACT studies. Mutations were in-frame deletions in exon 19 (n = 22), the L858R missense variant (n = 6), and other novel missense mutations (n = 4). For both IDEAL and INTACT, the overall frequency of mutations detected is consistent with reported EGFR mutation rates in NSCLC.14-28
Nucleotide sequencing tracings showed most mutations to be present at the expected ratio for heterozygous mutations. In some cases, however, apparent allelic imbalance raised the possibility of differential gene amplification. To explore this possibility, we used quantitative real time-PCR analysis to analyze gene copy numbers for EGFR, located at chromosome 7p, using two sets of controls: a marker at chromosome 7q and another on chromosome 4. Amplification of the EGFR locus was observed in seven of 90 IDEAL cases (8%) and 33 of 453 INTACT cases (7%). Amplification levels ranged from four-fold to more than 1,000-fold, with a median of eight-fold. Of 14 cases with gene amplification for which mutational status was available, 10 cases (80%) had amplification of wild-type EGFR. Of interest, EGFR amplification accounted for only a small subset of cases with high levels of protein expression as measured by immunohistochemistry, pointing to other mechanisms that regulate EGFR expression (Fig 1).
Clinical Correlates of EGFR Mutation Versus Amplification
Clinical responses to gefitinib have been observed more commonly in NSCLC with adenocarcinoma or bronchoalveolar histology, arising in nonsmokers, women, and patients of East Asian ethnicity.7,8 As shown in previous studies, these clinical features are well correlated with the presence of EGFR mutations.14-28 Consistent with this, in the IDEAL and INTACT trials, EGFR mutations were more frequent in adenocarcinomas (37 of 213; 17%) than in tumors with other histologies (nine of 178; 5%; P = .0001); in tumors from women (23 of 124; 19%) than men (23 of 267; 9%; P = .006); nonsmokers (14 of 55; 26%) than smokers (22 of 284; 8%; P = .0004); and Asians (five of 27; 19%) than non-Asians (41 of 364; 11%; P = .346; Table 4) . In contrast, there was no correlation between these gefitinib-responsive demographic groups and cases with EGFR amplification (Table 4). The frequency of EGFR amplification was 19 of 275 (7%) in adenocarcinomas and 21 of 267 (8%) in other histologies; five of 79 (6%) in nonsmokers and 31 of 381 (8%) in smokers; two of 39 (5%) in Asians and 38 of 504 (8%) in non-Asians (P value not significant). Lung cancers in women were somewhat more likely to have EGFR amplification (21 of 192, 11%) than those arising in men (19 of 351, 5%; P = .02). Taken together, there was no significant increase in the prevalence of EGFR amplification in cases with clinical features that are characteristic of strong responses to gefitinib. In addition, we observed that EGFR mutations were more prevalent in patients diagnosed before the age of 64 (37 of 259; 14%) compared with those diagnosed at a later age (nine of 132; 7%; P = .03). This was in contrast to EGFR amplification, which was more frequent in older patients (17 of 92; 18%) than in younger patients (23 of 351; 7%; P = .0009).
Responsiveness of NSCLC to Gefitinib
The response of NSCLC patients with different genotypes to single-agent gefitinib was evaluated in the IDEAL studies. In these studies, all patients received either of two doses of gefitinib, which showed no difference in response and hence, are grouped together in this analysis. Patients whose tumor had an EGFR mutation had a better response to gefitinib, with an OR of six of 13 (46%), compared with those lacking such mutations (six of 61 (10%); P = .005). Patients with more than four-fold amplification of EGFR also had a higher, but not statistically significant, probability of response to gefitinib (two of seven cases [29%]), compared with those with diploid or less than four-fold EGFR gene copy numbers (12 of 79 [15%]; P = .319). However, of the only two gefitinib-responsive patients with EGFR amplification, one had amplification of the mutant allele while the other had multiple copies of the wild-type allele. Given these small numbers of responses, the independent contribution of wild-type EGFR amplification to gefitinib-responsiveness cannot be determined. Altogether, in tumors analyzed for both mutations and amplification of EGFR, six of 10 patients (60%) with either genetic abnormality had a response to gefitinib, compared with five of 52 patients (10%) with neither amplification nor mutation (P = .0011). Median TTP for mutation positive cases was longer (116 days; range, 25 to 171), than that for mutation negative cases (57 days; range, 28 to 170). However, there was no impact on OS (Fig 2).
Additional Genetic Abnormalities in EGFR-Mutant NSCLC in IDEAL
Because only 46% of EGFR-mutant tumors responded to gefitinib, we addressed the possibility that the unresponsive tumors might have accrued additional genetic alterations modulating the drug sensitivity effect of the EGFR mutations. The T790M secondary EGFR mutation, recently correlated with acquired resistance to gefitinib,32-34 was not detected in any tumors from the IDEAL trial. Previous analyses of unselected cases of NSCLC indicated that EGFR and Kras mutations are mutually exclusive, leading to the hypothesis that activating mutations within Kras may prevent clinical response to EGFR inhibitors.35 However, we found no mutations at hotspot Kras codons 12, 13, or 61 in EGFR-mutant tumors that were either responsive (n = 5) or nonresponsive (n = 3) to gefitinib. We also considered the possibility that mutational inactivation of p53 might suppress apoptotic signals and relieve cells from their dependence on survival signals mediated by mutant EGFR. However, among EGFR-mutant tumors, p53 mutations were found in two out of six patients (33%) who responded to gefitinib and in one out of seven nonresponsive patients (14%; P = .13). Finally, given the role of PTEN in suppressing AKT activation, which appears to be critical in mediating gefitinib-sensitivity in EGFR-mutant tumors, we screened for PTEN expression using immunohistochemistry and sequenced mutational hotspots but found no association between loss of expression or mutation of PTEN and gefitinib-responsiveness in EGFR-mutant tumors. Thus, we did not identify known molecular abnormalities in NSCLC that modulate the response to single-agent gefitinib in EGFR-mutant tumors.
Addition of Gefitinib to Chemotherapy
The INTACT studies were randomized, placebo-controlled trials to test the effectiveness of chemotherapy combined with gefitinib in previously untreated NSCLC.9,10 In contrast to the success of combining trastuzumab (Herceptin; Genentech, South San Francisco, CA) with chemotherapy in breast cancer, the INTACT trials showed no overall benefit to patients treated with both chemotherapy and gefitinib compared with chemotherapy alone, raising concern that use of one therapeutic modality might, in fact, suppress the effectiveness of the other. Analysis of EGFR-mutant subgroups from the INTACT studies, therefore, allowed examination of the potential interaction between chemotherapy and gefitinib in patients likely to respond to the EGFR-TKI. Two different chemotherapy regimens were employed in these studies, along with two different doses of gefitinib, which are grouped here for purposes of analysis. Molecular analysis revealed that 13 of 18 EGFR-mutation carriers (72%) responded to chemotherapy plus gefitinib, compared with 84 of 152 mutation negative cases (55%), but this difference did not achieve statistical significance (P = .2). No difference in OR to combination chemotherapy-gefitinib was seen in cases with EGFR amplification (10 of 18; 56%) versus tumors without amplification (114 of 217; 53%). While the increased OR to combined therapy in EGFR-mutant tumors, compared with other subgroups, suggests that the addition of gefitinib to chemotherapy provided some benefit in these patients over chemotherapy alone, we could not directly address this question because of the small number of EGFR mutant tumors in the placebo arm of the trial: two of five EGFR-mutant tumors (40%) responded to chemotherapy alone while 13 of 18 (72%) responded to combination chemotherapy-gefitinib (P = .3). Among tumors with wild-type EGFR, 26 of 66 (39%) responded to chemotherapy alone versus 84 of 152 (55%) to combination chemotherapy-gefitinib; among tumors with EGFR amplification, three of six (50%) responded to chemotherapy versus 10 of 18 (56%) with combination treatment (P = 1.0).
OS was not affected by the addition of gefitinib to chemotherapy in patients with EGFR mutations (hazard ratio [HR];, 1.77; 95% CI, 0.50 to 6.23; Fig 3; Supplemental Tables 1 and 6). However, EGFR-mutant patients treated with chemotherapy alone had a better OS compared with mutation negative patients (median OS, 19.4 months v 9.2 months; HR, 0.48; 95% CI, 0.29 to 0.82), raising the possibility that this genetically defined subset of NSCLC may have a more favorable natural history and that EGFR mutations may also serve as a prognostic factor. A similar trend toward improved OS irrespective of gefitinib therapy was also seen for chemotherapy-treated patients with amplification of EGFR (median OS, > 20 months v 10.2 months; HR, 0.46; 95% CI, 0.25 to 0.83; Fig 3; Supplemental Tables 3 and 4). Consistent with this, progression-free survival was also slightly longer for mutation positive (median TTP, 6.7 months v 4.5 months; HR, 0.40; 95% CI, 0.23 to 0.71) or amplification positive (median TTP, 7.3 months v 4.6 months; HR, 0.37; 95% CI, 0.20 to 0.69) patients treated with chemotherapy irrespective of gefitinib therapy. Clinical characteristics suggest that EGFR mutations and amplification identify biologically distinct subsets of lung cancer (Table 4), despite the possibility that both may be associated with a better natural history. However, an improved OS for EGFR-mutant NSCLC was not evident in the IDEAL trials, involving pretreated patients rather than first line therapy. Hence, the determination of whether EGFR-mutant NSCLC bears a more favorable prognosis irrespective of therapy awaits carefully designed population studies.
DISCUSSION
The IDEAL and INTACT clinical trials were large, international phase II and phase III studies aimed at defining the clinical role of gefitinib, in NSCLC.7-10 Despite the virtually universal expression of the gefitinib target, EGFR, the trials had the unexpected result of identifying a small subset of NSCLC with dramatic responses to this drug, while many other patients progressed on therapy.7,8 The identification of EGFR mutations in the majority of gefitinib responders14-16,18-20,23,24,26-28,31 now allows an analysis of these clinical trials to define the contribution of molecular abnormalities in EGFR, using an unselected patient population. Although there are a number of biases that are inherent in an analysis such as this one, the patients available for molecular analysis appear to be a representative group.
Our studies confirm the now well-established association between EGFR mutations and gefitinib responsiveness. Previous studies have shown that approximately 80% of retroactively identified gefitinib-responsive NSCLC have activating mutations in the EGFR kinase,14-16,18-20,23,24,26-28,31 while only 50% of responders in the IDEAL trials had such mutations. This difference may reflect a bias in previous retrospective studies, which focused on cases with dramatic responses to gefitinib, whereas, the systematic inclusion of all cases with a PR in the IDEAL trials may have added cases with less remarkable responses attributable to other tumor characteristics. In addition, high throughput sequencing analysis of archival tumor specimens may have resulted in a lower mutation detection rate, compared with the smaller number of selected specimens analyzed previously.
Most significantly, the IDEAL studies allow calculation of the value of EGFR mutations in predicting drug response. Approximately 15% of NSCLC patients had a kinase mutation in EGFR and 46% of these went on to have an OR, following treatment with gefitinib, compared with 10% of mutation-negative patients (P = .005). Although the number of patients was too small to detect a clinically meaningful impact on OS, the presence of EGFR mutations was associated with increased TTP, including a small number of long-term responses. Recent studies, largely within Asian populations in which EGFR-mutant NSCLC is more prevalent, have reported that these mutations are predictive of both increased TTP and OS.20,23,27,28 By contrast, molecular analysis of EGFR within the recently published BR.21 phase II trial of erlotinib implies that mutations are only weakly predictive of response (16% of mutation positive cases responded v 7% of mutation negative cases).36 A meaningful comparison of data reported here and in the BR.21 study is confounded by differences in criteria used to score mutation-positive cases. All mutations reported here were reproducible in at least two independent PCR amplifications and 41 (89%) consisted of the known recurrent exon 19 deletions and L858R missense mutation. In contrast, 50% of mutations in the BR.21 study, representing 11% of all cases genotyped, were novel and unvalidated sequence variants identified in a single PCR-sequencing analysis.36 In our experience, the rate of false-positive mutational results using DNA extracted from paraffin-embedded tissue is high, underscoring the importance of duplicate analyses. Among the 77 IDEAL cases analyzed for mutations within exons 18-21, eight irreproducible nucleotide substitutions were identified among six cases (8%). Inclusion of such cases in the analysis of the BR.21 trial may account for the reported lower predictive value of mutations in the response to erlotinib.
Consistent with the oncogene addiction model,29 it is possible that EGFR-mutant cases that failed to respond may have had additional genetic lesions attenuating the dependence of tumor cells on mutant EGFR signaling. We did not detect secondary alterations in EGFR or mutations in Kras, p53, or PTEN that could explain this apparent resistance to gefitinib in some EGFR-mutant tumors. Nonetheless, we note that all mutational analyses were performed on tissue acquired at the time of initial diagnosis, whereas, patients underwent multiple rounds of chemotherapy before entering the IDEAL trials as third-line therapy. Additional mutations in EGFR or in other genes may have accrued during these chemotherapy courses. Clinical trials are under way to test whether the predictive value of EGFR mutations is enhanced when TKIs are administered at the time of initial diagnosis, tissue acquisition, and EGFR genotyping.
Amplification of the EGFR gene (> four-fold) was also evident in approximately 7% to 8% of cases, but it was not well-correlated with protein expression data measured by immunohistochemistry. For precise measurement of EGFR gene copy number, we used quantitative PCR (qPCR), with one control on the same chromosome as the EGFR gene and a second control on an unrelated chromosome with infrequent gene copy number changes in NSCLC. Compared with standard fluorescence in situ hybridization, qPCR allows more reliable distinction between specific amplification of EGFR and nonspecific aneuploidy with associated increased EGFR gene copies, and it also provides a more consistent measure of the mean gene copy number in a tumor cell population. Most tumors with EGFR amplification had multiple copies of the wild-type allele, although some also had amplification of the mutant sequence. The number of cases was too small to allow us to distinguish the effect of wild-type EGFR amplification, presumably resulting in increased but normal downstream signaling pathways versus that of mutant-EGFR amplification, which is associated with selective activation of downstream antiapoptotic signals.29,36 Among gefitinib responders 14% (two of 14) had amplified copies of EGFR, and 29% (two of seven) of NSCLC with EGFR amplification responded to gefitinib. Further studies will be required to determine whether amplification of wild-type EGFR in NSCLC is independently predictive of gefitinib response. Some studies of NSCLC, using fluorescence in situ hybridization, have proposed EGFR amplification as an important predictor of response,28,37 while analysis of glioblastomas, which are not responsive to gefitinib despite frequent EGFR amplification, has suggested otherwise.38 Nonetheless, combining our mutational and amplification data from the IDEAL studies, 60% of cases with either EGFR mutations or gene amplification responded to gefitinib, compared with 10% of cases without either genetic abnormality (P = .0011), supporting the hypothesis that genetic lesions in EGFR are critical in defining drug-susceptible subtypes of NSCLC.
The genotype analysis of the INTACT studies showed that the addition of gefitinib to standard chemotherapy regimens showed a trend toward an increased OR in EGFR-mutant patients but not in patients with EGFR amplification. The relatively high OR to chemotherapy alone in these previously untreated patients complicated the detection of a further contribution by gefitinib. Given the dramatic effectiveness of gefitinib in patients that do respond, no conclusion can be drawn about the benefit of simultaneous versus sequential therapy with TKIs and chemotherapy. The INTACT studies did show a significant increased survival of EGFR mutation-positive patients treated with chemotherapy, irrespective of gefitinib with a similar trend observed in patients with EGFR amplification. As noted above, while this difference may point to a relatively favorable natural history of these tumor subtypes, the enhanced survival of EGFR-mutant patients was not observed in the IDEAL studies, and hence, awaits confirmation in population-based studies. These findings are in agreement with the molecular analysis of a phase III trial of erlotinib (TRIBUTE) in which EGFR mutations appeared to be a positive prognostic indicator irrespective of EGFR-TKI treatment.39
An unexpected result of these molecular studies is that EGFR kinase mutations and gene amplification appear to identify different genetic subsets of NSCLC with clearly distinct features. As previously reported, kinase mutations are increased in adenocarcinomas, and in tumors arising in women, nonsmokers, and Asians, all features that were initially identified as clinical correlates or strong gefitinib responses in the IDEAL trials.7,8 We also note a trend toward earlier age of diagnosis, which had not been previously reported. In contrast, EGFR amplification is indistinguishable from the majority of NSCLC, with the expected proportion of tumor histologies, smoking history, and without sexual or ethnic predilection. Thus, EGFR mutations appear to identify a unique biologic subset of NSCLC, many of which are highly susceptible to therapy with gefitinib. Further studies will be required to determine the contribution of other molecular markers, including EGFR amplification, some of which may also provide insight into the more moderate responses to EGFR-TKIs seen in NSCLC patients classified as having stable disease.
The development of targeted therapy for common epithelial cancers has brought hope of effective treatments with relatively modest toxicity, modeled after the success of imatinib in specific hematologic malignancies. However, our understanding of the different genetic lesions driving NSCLC is limited; while EGFR mutations appear to be an important predictor of gefitinib responsiveness, some tumors with these mutations do not respond. Even in EGFR-mutant tumors that respond to gefitinib, the acquisition of drug resistance in many cases limits the impact on OS. Thus, improved OS in EGFR-TKI trials will require accurate identification of responsive subsets as well as approaches to circumvent the development of drug resistance. By analogy with the initial discovery of gefitinib-responsive NSCLC subsets in the IDEAL studies, further clues as to the determinants of long-term responses in EGFR-mutant tumors, may be derived from patients who have remained free from recurrence for 2 to 3 years.
Editor’s Note
Two related articles on this subject were published in the September 1, 2005, issue titled, TRIBUTE: A Phase III Trial of Erlotinib Hydrochloride (OSI-774) Combined With Carboplatin and Paclitaxel Chemotherapy in Advanced Non–Small-Cell Lung Cancer; by Roy S. Herbst, Diane Prager, Robert Hermann, Lou Fehrenbacher, Bruce E. Johnson, Alan Sandler, Mark G. Kris, Hai T. Tran, Pam Klein, Xin Li, David Ramies, David H. Johnson, and Vincent A. Miller (J Clin Oncol 23:5892-5899); and titled, Mutations in the Epidermal Growth Factor Receptor and in KRAS Are Predictive and Prognostic Indicators in Patients With Non–Small-Cell Lung Cancer Treated With Chemotherapy Alone and in Combination With Erlotinib; by David A. Eberhard, Bruce E. Johnson, Lukas C. Amler, Audrey D. Goddard, Sherry L. Heldens, Roy S. Herbst, William L. Ince, Pasi A. J?nne, Thomas Januario, David H. Johnson, Pam Klein, Vincent A. Miler, Michael A. Ostland, David A. Ramies, Dragan Sebisanovic, Jeremy A. Stinson, Yu R. Zhang, Somasekar Seshagiri, and Kenneth J. Hillan (J Clin Oncol 23:5900-5909).
Authors' Disclosures of Potential Conflicts of Interest
Although all authors completed the disclosure declaration, the following authors or their immediate family members indicated a financial interest. No conflict exists for drugs or devices used in a study if they are not being evaluated as part of the investigation. For a detailed description of the disclosure categories, or for more information about ASCO's conflict of interest policy, please refer to the Author Disclosure Declaration and the Disclosures of Potential Conflicts of Interest section in Information for Contributors.
Acknowledgment
We acknowledge the assistance of the INTACT and IDEAL trial investigators and AstraZeneca for provision of the tumor samples and clinical data. We thank David Louis, MD, and Gayatry Mohapatra, MD, for helpful discussions and Brian Holloway, MD, Emma Donald, MD, and Rafael Rosell, MD, for critical materials.
NOTES
Supported by Grant No. NIH PO1 95281 (D.W.B., D.A.H.), and the Doris Duke Foundation Distinguished Clinical Investigator Award (DAH), and a research grant from AstraZeneca, Wilmington, DE.
Authors' disclosures of potential conflicts of interest are found at the end of this article.
REFERENCES
Schiller JH, Harrington D, Belani CP, et al: Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med 346:92-98, 2002
Druker BJ, Talpaz M, Resta DJ, et al: Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med 344:1031-1037, 2001
Joensuu H, Roberts PJ, Sarlomo-Rikala M, et al: Effect of the tyrosine kinase inhibitor STI571 in a patient with a metastatic gastrointestinal stromal tumor. N Engl J Med 344:1052-1056, 2001
Demetri GD, von Mehren M, Blanke CD, et al: Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J Med 347:472-480, 2002
Weinstein IB: Cancer. Addiction to oncogenes–the Achilles heal of cancer. Science 297:63-64, 2002
Wakeling AE, Guy SP, Woodburn JR, et al: ZD1839 (Iressa): an orally active inhibitor of epidermal growth factor signaling with potential for cancer therapy. Cancer Res 62:5749-5754, 2002
Kris MG, Natale RB, Herbst RS, et al: Efficacy of gefitinib, an inhibitor of the epidermal growth factor receptor tyrosine kinase, in symptomatic patients with non-small cell lung cancer: A randomized trial. JAMA 290:2149-2158, 2003
Fukuoka M, Yano S, Giaccone G, et al: Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer. J Clin Oncol 21:2237-2246, 2003
Giaccone G, Herbst RS, Manegold C, et al: Gefitinib in combination with gemcitabine and cisplatin in advanced non-small-cell lung cancer: A phase III trial–INTACT 1. J Clin Oncol 22:777-784, 2004
Herbst RS, Giaccone G, Schiller JH, et al: Gefitinib in combination with paclitaxel and carboplatin in advanced non-small-cell lung cancer: A phase III trial–INTACT 2. J Clin Oncol 22:785-794, 2004
Gatzemeier U, Pluzanska A, Szczesna A, et al: Results of a phase III trial of erlotinib (OSI-774) combined with cisplatin and gemcitabine (GC) chemotherapy in advanced non-small cell lung cancer (NSCLC). J Clin Oncol 22:619S, 2004 (suppl 14S; abstr 7010)
Herbst RS, Prager D, Hermann R, et al: TRIBUTE: A phase III trial of erlotinib hydrochloride (OSI-774) combined with carboplatin and paclitaxel chemotherapy in advanced non-small-cell lung cancer. J Clin Oncol 23:5892-5899, 2005
Bailey LR, Kris M, Wolf M, et al: Tumor EGFR membrane staining is not clinically relevant for predicting response in patients receiving gefitinib ('Iressa', ZD1839) monotherapy for pretreated advanced non-small-cell lung cancer: IDEAL 1 and 2. Proc Am Assoc Cancer Res 44:1362, 2003 (abstr LB-170)
Lynch TJ, Bell DW, Sordella R, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350:2129-2139, 2004
Paez JG, Janne PA, Lee JC, et al: EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science 304:1497-1500, 2004
Pao W, Miller V, Zakowski M, et al: EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 101:13306-13311, 2004
Kosaka T, Yatabe Y, Endoh H, et al: Mutations of the epidermal growth factor receptor gene in lung cancer: Biological and clinical implications. Cancer Res 64:8919-8923, 2004
Huang SF, Liu HP, Li LH, et al: High frequency of epidermal growth factor receptor mutations with complex patterns in non-small cell lung cancers related to gefitinib responsiveness in Taiwan. Clin Cancer Res 10:8195-8203, 2004
Tokumo M, Toyooka S, Kiura K, et al: The relationship between epidermal growth factor receptor mutations and clinicopathologic features in non-small cell lung cancers. Clin Cancer Res 11:1167-1173, 2005
Mitsudomi T, Kosaka T, Endoh H, et al: Mutations of the epidermal growth factor receptor gene predict prolonged survival after gefitinib treatment in patients with non-small-cell lung cancer with postoperative recurrence. J Clin Oncol 11:1-8, 2005
Marchetti A, Martella C, Felicioni L, et al: EGFR mutations in non-small-cell lung cancer: Analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment. J Clin Oncol 23:857-865, 2005
Shigematsu H, Lin L, Takahashi T, et al: Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst 97:339-346, 2005
Han SW, Kim TY, Hwang PG, et al: Predictive and prognostic impact of epidermal growth factor receptor mutation in non-small-cell lung cancer patients treated with Gefitinib. J Clin Oncol 23:2493-2501, 2005
Kim KS, Jeong JY, Kim YC, et al: Predictors of the response to gefitinib in refractory non-small cell lung cancer. Clin Cancer Res 11:2244-2251, 2005
Yang SH, Mechanic LE, Yang P, et al: Mutations in the tyrosine kinase domain of the epidermal growth factor receptor in non-small cell lung cancer. Clin Cancer Res 11:2106-2110, 2005
Cho D, Kocher O, Lee JC, et al: Unusual cases in multiple myeloma and a dramatic response in metastatic lung cancer: Case 4. Mutation of the epidermal growth factor receptor in an elderly man with advanced, gefitinib-responsive, non-small-cell lung cancer. J Clin Oncol 23:235-237, 2005
Chou TY, Chiu CH, Li LH, et al: Mutation in the tyrosine kinase domain of epidermal growth factor receptor is a predictive and prognostic factor for gefitinib treatment in patients with non-small cell lung cancer. Clin Cancer Res 11:3750-3757, 2005
Cappuzzo F, Hirsch FR, Rossi E, et al: Epidermal growth factor receptor gene and protein and gefitinib sensitivity in non-small-cell lung cancer. J Natl Cancer Inst 97:643-655, 2005
Sordella R, Bell DW, Haber DA, et al: Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science 305:1163-1167, 2004
Tracy S, Mukohara T, Hansen M, et al: Gefitinib induces apoptosis in the EGFRL858R non-small-cell lung cancer cell line H3255. Cancer Res 64:7241-7244, 2004
Amann J, Kalyankrishna S, Massion PP, et al: Aberrant epidermal growth factor receptor signaling and enhanced sensitivity to EGFR inhibitors in lung cancer. Cancer Res 65:226-235, 2005
Pao W, Miller VA, Politi KA, et al: Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Med 2:e73, 2005
Kobayashi S, Boggon TJ, Dayaram T, et al: EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med 352:786-792, 2005
Kwak EL, Sordella R, Bell DW, et al: Irreversible inhibitors of the EGF receptor may circumvent acquired resistance to gefitinib. Proc Natl Acad Sci U S A 102:7665-7670, 2005
Pao W, Wang TY, Riely GJ, et al: KRAS mutations and primary resistance of lung adenocarcinomas to Gefitinib or Erlotinib. PLoS Med 2:e17, 2005
Tsao MS, Sakurada A, Cutz JC, et al: Erlotinib in lung cancer –molecular and clinical predictors of outcome. N Engl J Med 353:133-144, 2005
Hirsch FR, Varella-Garcia M, McCoy J, et al: Increased epidermal growth factor receptor gene copy number detected by fluorescence in situ hybridization associates with increased sensitivity to gefitinib in patients with bronchioloalveolar carcinoma subtypes: A Southwest Oncology Group Study. J Clin Oncol (Epub ahead of print) 2005
Rich JN, Reardon DA, Peery T, et al: Phase II trial of gefitinib in recurrent glioblastoma. J Clin Oncol 22:133-142, 2004
Eberhard DA, Johnson BE, Amler LC, et al: Mutations in the epidermal growth factor receptor and in KRAS are predictive and prognostic indicators in patients with non-small-cell lung cancer treated with chemotherapy alone and in combination with erlotinib. J Clin Oncol 23:5900-5909, 2005
查询更多Growth相关信息在本站>>
《临床肿瘤学医学期刊》2005年11月第23卷第11期
|