您的位置: 百康网 > 期刊 > 内科学 > 《中风学杂志》 > 2006年5月第5期 > 正文
Deletion of Cellular Prion Protein Results in Reduced Akt Activation, Enhanced Postischemic Caspase-3 Activation, and Exacerbation of Ischemic Brain Injury
http://www.100kang.com 2007-5-10 23:51:18 proteins


    the Departments of Neurology (J.W., R.S., S.S., O.C., I.Z., M.B.) and Neuropathology (A.W., W.S.-S.), University of Goettingen Medical School, Germany.

    Abstract

    Background and Purpose— The physiological function of cellular prion protein (PrPc) is not yet understood. Recent findings suggest that PrPc may have neuroprotective properties, and its absence increases susceptibility to neuronal injury. The purpose of this study was to elucidate the role of PrPc in ischemic brain injury in vivo.

    Methods— PrP knockout (Prnp0/0) and Prnp+/+ wild-type (WT) mice were subjected to 60-minute transient or permanent focal cerebral ischemia followed by infarct volume analysis 24 hours after lesion. To identify effects of PrPc deletion on mechanisms regulating ischemic cell death, expression analysis of several proapoptotic and antiapoptotic proteins was performed at 6 and 24 hours after transient ischemia and in nonischemic controls using Western blot or immunohistochemistry.

    Results— Prnp0/0 mice displayed significantly increased infarct volumes after both transient or permanent ischemia when compared with WT animals (70.2±23 versus 13.3±4 mm3; 119.8±24 versus 86.4±25 mm3). Expression of phospho-Akt (Ser473) was significantly reduced in Prnp0/0 compared with WT animals both early after ischemia and in sham controls. Furthermore, postischemic caspase-3 activation was significantly enhanced in the basal ganglia and the parietal cortex of Prnp0/0 mice. In contrast, expression of total Akt, Bax, and Bcl-2 did not differ between both groups.

    Conclusions— These results demonstrate that PrPc deletion impairs the antiapoptotic phosphatidylinositol 3-kinase/Akt pathway by resulting in reduced postischemic phospho-Akt expression, followed by enhanced postischemic caspase-3 activation, and aggravated neuronal injury after transient and permanent cerebral ischemia.

    Key Words: caspases  cerebral ischemia  PrPc proteins  signal transduction

    Introduction

    The pathological isoform of the prion protein (PrPSc) mediates transmissible spongiform encephalopathies like Creutzfeldt–Jakob disease. In contrast, the physiological function of the cellular prion protein (PrPc) is still unknown. Recent findings suggest that PrPc has neuroprotective properties and that its deletion increases susceptibility to neuronal injury in vitro and in vivo.1–4 However, molecular mechanisms underlying PrPc-mediated neuroprotection are still poorly understood and complex.5 Various in vitro studies have shown that in addition to its interaction with synaptic proteins (synapsin Ib and Grb2) and cell adhesion molecules,6,7 PrPc can also mediate the activation of several signal transduction pathways, including protein kinase A, Fyn, phosphatidylinositol 3-kinase (PI3K)/Akt, and mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) known to promote neuronal survival.8–11 In addition, cytosolic PrPc has been demonstrated to interact with proteins of the Bcl-2 family.12 Other studies have suggested that PrPc mediates neuroprotection by counteracting oxidative stress. Activities of key antioxidant enzymes (Cu/Zn superoxide dismutase and glutathione reductase) seem to correlate with PrPc levels,13,14 and markers of oxidative stress are increased in brains of Prnp0/0 mice.15 Furthermore, cell lines from Prnp0/0 mice are more susceptible to copper or H2O2 induced toxicity,16,17 and PrPc expression is upregulated after focal cerebral ischemia in vivo depending on lesion severity.18 Recently, it has been suggested that PrPc deletion results in aggravation of neuronal injury after mild focal cerebral ischemia,4 possibly mediated by increased ERK1/2 and STAT-1 activation.19 However, molecular mechanisms underlying exacerbation of ischemic brain injury after PrPc deletion require further characterization. Furthermore, the relevance of PrPc deletion for ischemic injury after severe permanent cerebral ischemia has not been established yet.

    Therefore, we analyzed the extent of ischemic brain injury in Prnp0/0 and wild-type (WT) mice after both transient and permanent focal cerebral ischemia. To elucidate effects of PrPc deletion on molecular mechanisms involved in regulating ischemia-induced cell death, we performed an expression analysis of various proapoptotic and antiapoptotic proteins including Akt, phospho-Akt, Bax, Bcl-2, and activated caspase-3 in Prnp0/0 and WT mice at different time points after transient ischemia and under nonischemic conditions.

    Materials and Methods

    Transgenic Mice and Genotype Analysis

    Adult male PrPc knockout (Prnp0/0) mice and Prnp+/+ WT mice weighing 22 to 27 g were used. All Prnp0/0 and Prnp+/+ mice used in this study had the same genetic background (129/Sv(ev)xC57BL/6J) and were homozygous descendants of Fl generation Prnp0/+ breeding pairs, which were generated as described previously.20,21 Prnp0/0 and WT mice (original animals gifts from C. Weissmann, University of Zurich, Switzerland) were propagated over multiple generations and recurrently tested for Prnp genotype.

    All mice used in this study were genotyped using a published polymerase chain reaction (PCR) protocol using 3 primers (RK1: TCAGCCTAAATACTGGGCAC; RK2: GCCTAGACCACGAGAAATGC; and RK3: GCATCAGCCATGATGGATAC) to identify either the nontransgenic PrP gene in WT mice (combining RK1+RK2) or the disrupted PrP gene in Prnp0/0 mice (RK1+RK3: amplification of a 730-bp fragment containing the Neo cassette).21 DNA was extracted from tail biopsies of all mice used. PCR mixture contained 200 μmol/L each dNTP, 0.4 μmol/L RK1, 0.4 μmol/L RK2, 0.4 μmol/L RK3, 1.25 U of Taq DNA Polymerase (Promega), 5 mmol/L TrisHCl, pH 8.0, 10 mmol/L NaCl, and 0.9 mmol/L MgCl2. PCR was performed as follows: 1 cycle at 95°C, 120 seconds followed by 35 cycles: starting with 95°C, 60 seconds for denaturation; followed by 62°C, 60 seconds for annealing and completed by 72°C, 60 seconds for polynucleotide extension. PCR was completed by a final step at 72°C, 300 seconds.

    Animals were kept under diurnal conditions and allowed free access to food and water.

    Induction of Focal Cerebral Ischemia

    All experimental procedures were performed according to the National Institutes of Health guidelines for the care and use of laboratory animals and approved by local authorities. Animals were anesthetized with 1% to 1.5% isofluran (30% O2, remainder N2O). Rectal temperature was maintained at 36.5°C to 37°C using a feedback-controlled heating system. For assessment of cerebral blood flow (CBF), laser Doppler flow was recorded during all experiments using a 0.5-mm fiber optic probe (Perimed) attached to the skull overlying the core region of the middle cerebral artery (MCA) territory (2-mm posterior, 6-mm lateral from bregma). Focal cerebral ischemia was induced by permanent or transient occlusion of the MCA using the intraluminal filament technique as described previously.18 After a midline neck incision, the left common and external carotid artery were isolated and ligated. After placing a microvascular clip (Aesculap) on the internal carotid artery, an 8–0 silicon resin (Xantopren)–coated nylon monofilament (Ethilon; diameter 180 to 200 μm; Ethicon) was introduced through an incision into the distal part of the common carotid artery and, after clip removal, advanced 9 mm distal from the carotid bifurcation for MCA occlusion.

    For permanent ischemia, the thread was left in situ and fixed by ligation of the distal common carotid artery. For transient ischemia, the monofilament was withdrawn after 60 minutes of ischemia to allow reperfusion of the MCA. Laser Doppler flow recording continued for 15 minutes after the end of operations to monitor either permanent reduction of CBF (<30% of initial CBF) or appropriate reperfusion.

    Infarct Volume Analysis

    Prnp0/0 and WT mice were euthanized by an overdose of isofluran 24 hours after induction of transient (n=6 per group) or permanent (n=8 per group) cerebral ischemia. Brains were removed, sectioned into 5 equidistant slices (slice thickness: 2 mm), and incubated with a 2% 2,3,5-triphenyle-tetrazoliumchloride solution (15 minutes) to visualize infarcted tissue. Areas of infarction were measured by subtracting the nonlesioned area of the left (infarcted) hemisphere from the area of the right (noninfarcted) hemisphere in all slices using an image analysis system (NIH Image 3.12). Infarct volumes were calculated by integration of lesion areas.

    Western Blot Analysis

    Prnp0/0 and WT mice were euthanized by an overdose of isofluran at 6 and 24 hours (n=4 per group and time point) after onset of transient cerebral ischemia. Sham-operated Prnp0/0 and WT mice (n=4 per group) were used as nonischemic controls. Brains were removed and shock-frozen. Left (ischemic) hemispheres of individual mice were complemented with lysis buffer (50 mmol/L Tris, pH 8.0, 150 mmol/L NaCl, 1% Triton X-100, and protease inhibitors), homogenized, centrifuged, and supernatants used for SDS-PAGE.

    For Western blot analysis, equal amounts of protein (40 μg) were diluted in 6x sample buffer, boiled, and loaded onto 10% to 15% polyacrylamide gels. Proteins were transferred onto polyvinylidene difluoride membranes, which were immersed in blocking solution (5% milk, 0.1% Tween 20 in TBS) for 1 hour at room temperature (RT) and incubated with different mouse monoclonal (anti-Bcl-2: 1:1000; Santa Cruz Biotechnology; anti–-tubulin [loading control]: 1:5000; Sigma-Aldrich) or rabbit polyclonal (anti–phospho-Akt (Ser473)/anti-Akt: 1:1000; Cell Signaling; anti-Bax: 1:1000; Santa Cruz Biotechnology) antibodies in 5% BSA/Tris-buffered saline with Tween-20 (TBST) (18 hours; 4°C). Membranes were incubated with a peroxidase-coupled, goat anti-mouse or anti-rabbit secondary antibody (1:2000 in 1% milk/TBST; Santa Cruz Biotechnology; 1 hour at RT), immersed in enhanced chemiluminescence (ECL) solution, and exposed to ECL-Hyperfilm (Amersham).

    The intensity of each Akt and phospho-Akt band was measured by densitometry (ScanMaker4; Microtek International) and normalized to intensities of corresponding -tubulin bands (internal control) by calculating densitometry ratios Akt/-tubulin and phospho-Akt/-tubulin.

    Activated Caspase-3 Immunohistochemistry

    Prnp0/0 and WT mice were intraperitoneally injected with chloralhydrate (420 mg/kg body weight) and transcardiacally perfused with 4% paraformaldehyde at 6 and 24 hours after onset of ischemia (n=3 per group/time point). Brains were removed, postfixed in paraformaldehyde, embedded in paraffin, and 2-μm coronar sections were prepared. Sections were deparaffinized, boiled in 0.2% citrate buffer, incubated with blocking solution (0.3% Triton X-100; 10% normal goat serum (NGS) in PBS; 1 hour at RT), and a rabbit polyclonal anti-activated caspase-3 antibody (1:1000 in 2% NGS, 0.3% Triton X; overnight at RT; CM-1; Becton Dickinson). After several washing steps and staining with a goat anti-rabbit, Cy-3–conjugated secondary antibody (1:400; Dianova; 1 hour at RT), sections were stained with 4',6-diamidino-2-phenylindole (nuclear staining).

    For activated caspase-3/NeuN double staining, sections were incubated with the rabbit polyclonal anti-activated caspase-3 antibody (CM1, see above) and a mouse monoclonal anti-NeuN antibody (1:500; Chemicon International) overnight at 4°C, followed by staining with a goat anti-rabbit Cy-3–conjugated (see above) and a goat anti-mouse fluorescein isothiocyanate–conjugated secondary antibody (1:100; Sigma-Aldrich; 1 hour at RT). Subsequently, sections were analyzed for activated caspase-3/NeuN colocalization.

    Quantitative Analysis of Activated Caspase-3 Expression

    Cell counts of activated caspase-3–positive cells were performed in ischemic basal ganglia (4 visual fields per section; total area 1.6 mm2, including medial and lateral striatum) and parietal cortex (2 visual fields per section; total area 0,8 mm2) of Prnp0/0 and WT mice 24 hours after induction of transient ischemia (n=3 per group). To standardize cell counts, areas to be analyzed within the 2 brain regions were defined by stereotactic coordinates. Four corresponding sections per animal and region were analyzed. Data are given as number of activated caspase-3–positive cells per mm2.

    Statistical Analysis

    All values are given as mean±SEM. Normal distribution of the data were tested and confirmed using the Kolgoroff–Smirnoff Test. Statistical analysis was performed using the 2-sided Student t test (infarct volume analysis, analysis of activated caspase-3–positive cells; statistical significance: P values <0.05) or 1-way ANOVA followed by the Tukey HSD (honestly significant difference) test (Western Blot analysis of phospho-Akt/Akt).

    Results

    Infarct Volumes Are Increased in Prnp0/0 Mice

    Quantitative analysis showed significantly increased infarct volumes in Prnp0/0 compared with WT mice after both 60-minute transient (70.2±23 mm3 versus 13.3±4 mm3) and permanent (119.8±24 mm3 versus 86.4±25 mm3) focal cerebral ischemia (Figures 1 and 2). After transient ischemia, infarctions in WT mice were restricted to small parts of the striatum, whereas in Prnp0/0 mice, lesions included substantial parts of the basal ganglia (especially the striatum) and parts of the parietal cortex (Figure 2C and 2D).

    Reduction of CBF and the extent of reperfusion (after transient ischemia) were not significantly different between Prnp0/0 and WT animals (data not shown).

    Reduced Phospho-Akt Expression in Prnp0/0 Mice

    Quantitative Western blot analysis of phosphorylated (ie, activated) Akt and total Akt expression revealed significant phospho-Akt upregulation 6 hours after transient ischemia compared with nonischemic controls in WT but not Prnp0/0 mice. Moreover, phospho-Akt expression in nonischemic controls and especially 6 hours after induction of ischemia was significantly reduced in Prnp0/0 compared with WT mice (Figure 3A and 3B). Twenty-four hours after lesion, we observed a trend for higher phospho-Akt expression in WT mice, but differences were not statistically significant. In contrast, total Akt expression did not significantly differ between Prnp0/0 and WT animals, both after ischemia and in nonischemic controls (Figure 3A; densitometric data not shown). This suggests impaired Akt activation in Prnp0/0 mice with reduced phospho-Akt expression early after ischemic brain injury and in nonischemic mice.

    Enhanced Postischemic Neuronal Caspase-3 Activation in Prnp0/0 Mice

    Quantitative analysis of antiactivated caspase-3 immunohistochemistry revealed a significant increase in the number of activated caspase-3–positive cells in the basal ganglia and in the adjacent parietal cortex of ischemic hemispheres in Prnp0/0 compared with WT animals at 24 hours after transient ischemia (Figures 4 and 5). Double-staining experiments with the neuron-specific marker NeuN revealed that caspase-3 activation occurred predominantly in neurons (Figure 4). Six hours after onset of ischemia, we observed only very few activated caspase-3–positive cells within the striatum of both Prnp0/0 and WT animals (data not shown). This suggests enhanced postischemic apoptosis in Prnp0/0 mice.

    Expression of Bax and Bcl-2 Does Not Differ Between Prnp0/0 and WT Mice

    Western blot analysis of Bax and Bcl-2 expression at 6 and 24 hours after onset of transient ischemia and in nonischemic controls did not reveal relevant differences between Prnp0/0 and WT mice (Figure 6). This argues against a relevant interaction of PrPC with Bax and Bcl-2 expression after cerebral ischemia in vivo.

    Discussion

    Although the exact physiological function of PrPc is still elusive, there is accumulating evidence for its association with molecular mechanisms and signaling pathways that mediate cell survival after neuronal injury.5 PrPc deletion has been linked to increased susceptibility to neuronal injury in vitro1,2,16 and traumatic and mild ischemic brain injury in vivo.19,22 In vitro studies have suggested that neuroprotective actions of PrPc may be mediated by different mechanisms, including activation of neuroprotective signal transduction pathways, direct anti-Bax function, and regulation of antioxidant enzyme activities.9–11,17 However, molecular mechanisms underlying PrPc-dependent susceptibility to ischemic brain injury in vivo and the influence of lesion severity on PrPc-mediated neuroprotection require further investigation. The present study demonstrates that PrPc deletion results in exacerbation of ischemic brain injury after transient and permanent focal ischemia and identified reduced Akt activation and enhanced caspase-3 activation in Prnp0/0 mice as possible underlying mechanisms.

    The antiapoptotic PI3K/Akt/phospho-Akt pathway mediates neuronal survival after cerebral ischemia.23,24 Blocking this pathway increases activation of caspase-3, a crucial mediator of apoptosis.25 Furthermore, it has been demonstrated that transient early postischemic upregulation of phospho-Akt occurs in the cortex but not the ischemic core and is associated with reduced TUNEL staining after transient ischemia.24 We therefore hypothesize that reduced phospho-Akt levels in Prnp0/0 mice early after stroke lead to enhanced postischemic apoptosis reflected in larger infarcts. This hypothesis is supported by our observation that the number of activated caspase-3 expressing neurons is significantly higher in Prnp0/0 than in WT animals, especially in the parietal cortex. Because total Akt levels do not differ between Prnp0/0 and WT animals, lower phospho-Akt expression in Prnp0/0 mice is attributable to reduced Akt phosphorylation. This is in line with a recent study demonstrating lower PI3K activity, an upstream regulator of Akt phosphorylation, in neuronal cells from mice lacking PrPc compared with WT cells.11

    In contrast to another study reporting increased basal cerebral expression of Bax and Bcl-2 in Prnp0/0 mice,13 we did not detect relevant differences in Bax and Bcl-2 expression between Prnp0/0 and WT animals in nonischemic brains or after transient ischemia. In our view, this argues against a relevant role for Bax and Bcl-2 in PrPc-dependent susceptibility to cerebral ischemia.

    Short transient and permanent focal cerebral ischemia differ with regard to the molecular mechanisms involved in mediating postischemic cell death. Whereas permanent ischemia (by proximal MCA occlusion) leads to large infarcts with neuronal damage primarily mediated by excitotoxicity and necrosis, short transient ischemia results primarily in apoptotic cell death, especially in the penumbra.26 Considering these differences, we tried to establish whether PrPc deletion is relevant for infarct development after both transient and permanent ischemia. Although PrPc deletion led to significantly increased infarct volumes after transient and permanent ischemia, differences were more pronounced after transient ischemia. This may be attributable to the predominant role of neuronal apoptosis and the importance of the PI3K/Akt pathway after transient ischemia as opposed to a lesser significance after permanent ischemia. However, additional pathways (eg, MAPK/ERK19) or molecular events mediating necrotic cell death (eg, poly(ADP-ribose)polymerase [PARP] activation) may also contribute to enhanced ischemic brain injury in Prnp0/0 mice.

    In summary, our results demonstrate that PrPc deletion impairs the antiapoptotic PI3K/Akt pathway by leading to reduced postischemic phospho-Akt expression, followed by enhanced postischemic caspase-3 activation, and aggravated neuronal injury after both transient and permanent cerebral ischemia in vivo.

    Acknowledgments

    We thank Barbara Müller for excellent technical assistance.

    References

    Kuwahara C, Takeuchi A, Nishimura T, Haraguchi K, Kubosaki A, Matsumoto Y, Saeki K, Matsumoto Y, Yokoyama T, Itohara S, Onodera T. Prions prevent neuronal cell-line death. Nature. 1999; 400: 225–226.

    Bounhar Y, Zhang Y, Goodyer CG, LeBlanc A. Prion protein protects human neurons against Bax-mediated apoptosis. J Biol Chem. 2001; 276: 39145–39149.

    Roucou X, Guo G, Zhang Y, Goodyer CG, LeBlanc AC. Cytosolic prion protein is not toxic and protects against Bax-mediated cell death in human primary neurons. J Biol Chem. 2003; 278: 40877–40881.

    McLennan NF, Brennan PM, McNeill A, Davies I, Fotheringham A, Rennison KA, Ritchie D, Brannan F, Head MW, Ironside JW, Williams A, Bell JE. Prion protein accumulation and neuroprotection in hypoxic brain damage. Am J Pathol. 2004; 165: 227–235.

    Roucou X, Gains M, LeBlanc AC. Neuroprotective functions of prion protein. J Neurosci Res. 2004; 75: 153–161.

    Schmitt-Ulms G, Legname G, Baldwin MA, Ball HL, Bradon N, Bosque PJ, Crossin KL, Edelman GM, DeArmond SJ, Cohen FE, Prusiner SB. Binding of neural cell adhesion molecules (N-CAMs) to the cellular prion protein. J Mol Biol. 2001; 314: 1209–1225.

    Spielhaupter C, Schatzl HM. PrPc directly interacts with proteins involved in signaling pathways. J Biol Chem. 2001; 276: 44604–44612.

    Mouillet-Richard S, Ermonval M, Chebassier C, Laplanche JL, Lehmann S, Launay JM, Kellermann O. Signal transduction through prion protein. Science. 2000; 289: 1925–1928.

    Chiarini LB, Freitas ARO, Zanata SM, Brentani RR, Martins VR, Linden R. Cellular prion protein transduces neuroprotective signals. EMBO J. 2002; 21: 3317–3326.

    Chen S, Mange A, Dong L, Lehmann S, Schachner M. Prion protein as trans-interacting partner for neurons is involved in neurite outgrowth and neuronal survival. Mol Cell Neurosci. 2003; 22: 227–233.

    Vassallo N, Herms J, Behrens C, Krebs B, Saeki K, Onodera T, Windl O, Kretzschmar HA. Activation of phosphatidylinositol 3-kinase by cellular prion protein and its role in cell survival. Biochem Biophys Res Comm. 2005; 332: 75–82.

    Kurschner C, Morgan J. Analysis of interaction sites in homo- and heteromeric complexes containing Bcl-2 family members and the cellular prion protein. Brain Res Mol Brain Res. 1996; 37: 249–258.

    Brown DR, Nicholas RS, Canevari L. Lack of prion protein expression results in a neuronal phenotype sensitive to stress. J Neurosci Res. 2002; 67: 211–224.

    Rachidi W, Vilette D, Guiraud P, Arlotto M, Riondel J, Laude H, Lehmann S, Favier A. Expression of prion protein increases cellular copper binding and antioxidant enzyme activities but not copper delivery. J Biol Chem. 2003; 278: 9064–9072.

    Wong BS, Liu T, Li R, Pan T, Petersen RB, Smith MA, Gambetti P, Perry G, Manson JC, Brown DR, Sy MS. Increased levels of oxidative stress markers detected in the brains of mice devoid of prion protein. J Neurochem. 2001; 76: 565–572.

    Brown DR, Schulz-Schaeffer WJ, Schmidt B, Kretzschmar HA. Prion protein-deficient cells show altered response to oxidative stress due to decreased SOD-1 activity. Exp Neurol. 1997; 146: 104–112.

    White AR, Collins SJ, Maher F, Jobling MF, Stewart LR, Thyer JM, Beyreuther K, Masters CL, Cappai R. Prion protein-deficient neurons reveal lower glutathione reductase activity and increased susceptibility to hydrogen peroxide toxicity. Am J Pathol. 1999; 155: 1723–1730.

    Weise J, Crome O, Sandau R, Schulz-Schffer W, Bhr M, Zerr I. Upregulation of cellular prion protein (PrPc) after focal cerebral ischemia and influence of lesion severity. Neurosci Lett. 2004; 372: 146–150.

    Spudich A, Frigg R, Kilic E, Kilic U, Oesch B, Raeber A, Bassetti CL, Hermann DM. Aggravation of ischemic brain injury by prion protein deficiency: role of ERK-1/-2 and STAT-1. Neurobiol Dis. 2005; 20: 442–449.

    Bueler H, Fischer M, Lang Y, Bluethmann H, Lipp HP, DeArmond SJ, Prusiner SB, Aguet M, Weissmann C. Normal development and behavior of mice lacking the neuronal cell-surface PrP protein. Nature. 1992; 356: 577–582.

    Prusiner SB, Groth D, Serban A, Koehler R, Foster D, Torchia M, Burton D, Yang SL, DeArmond SJ. Ablation of the prion protein (PrP) gene in mice prevents scrapie and facilitates production of anti-PrP antibodies. Proc Natl Acad Sci U S A. 1993; 90: 10608–10612.

    Hoshino S, Inoue K, Yokoyama T, Kobayashi S, Asakura T, Teramoto A, Itohara S. Prions prevent brain damage after experimental brain injury: a preliminary report. Acta Neurochir (Suppl). 2003; 86: 297–299.

    Limbourg FP, Huang Z, Plumier JC, Simoncini T, Fujioka M, Tuckermann J, Schutz G, Moskowitz MA, Liao JK. Rapid nontranscriptional activation of endothelial nitric oxide synthase mediates increased cerebral blood flow and stroke protection by corticosteroids. J Clin Invest. 2002; 110: 1729–1738.

    Noshita N, Lewen A, Sugawara T, Chan PH. Evidence of phosphorylation of Akt and neuronal survival after transient focal cerebral ischemia in mice. J Cereb Blood Flow Metab. 2001; 21: 1442–1450.

    Uddin S, Hussain AR, Al-Hussein KA, Manogaran PS, Wickrema A, Gutierrez MI, Bhatia KG. Inhibition of phosphatidylinositol 3'- kinase/AKT signaling promotes apoptosis of primary effusion lymphoma cells. Clin Cancer Res. 2005; 11: 3102–3108.

    Graham SH, Chen J. Programmed cell death in cerebral ischemia. J Cereb Blood Flow Metab. 2001; 21: 99–109.


  
《中风学杂志》2006年5月第37卷第5期