the Department of Medicine (R.K., M.S., M.H., E.M.M.) and Committee on Cell Physiology (D.A.S.), The University of Chicago, Ill
the Department of Medicine (B.Y., N.-Q.S., K.G., J.C.M.), University of Wisconsin, Madison.
Abstract
In the vasculature, ATP-sensitive potassium channels (KATP) channels regulate vascular tone. Mice with targeted gene disruptions of KATP subunits expressed in vascular smooth muscle develop spontaneous coronary vascular spasm and sudden death. From these models, it was hypothesized that the loss of KATP channel activity in arterial vascular smooth muscle was responsible for coronary artery spasm. We now tested this hypothesis using a transgenic strategy where the full-length sulfonylurea receptor containing exon 40 was expressed under the control of a smooth muscleeCspecific SM22 promoter. Two transgenic founder lines were generated and independently bred to sulfonylurea receptor 2 (SUR2) null mice to generate mice that restored expression of KATP channels in vascular smooth muscle. Transgenic expression of the sulfonylurea receptor in vascular smooth muscle cells was confirmed by detecting mRNA and protein from the transgene. Functional restoration was determined by recording pinacidil-based KATP current by whole cell voltage clamping of isolated aortic vascular smooth muscle cells isolated from the transgenic restored mice. Despite successful restoration of KATP channels in vascular smooth muscle, transgene-restored SUR2 null mice continued to display frequent episodes of spontaneous ST segment elevation, identical to the phenotype seen in SUR2 null mice. As in SUR2 null mice, ST segment elevation was frequently followed by atrioventricular heart block. ST segment elevation and coronary perfusion pressure in the restored mice did not differ significantly between transgene-negative and transgene-positive SUR2 null mice. We conclude that spontaneous coronary vasospasm and sudden death in SUR2 null mice arises from a coronary artery vascular smooth muscleeCextrinsic process.
Key Words: KATP channel sulfonylurea receptor vasospasm smooth muscle
Introduction
ATP-sensitive potassium (KATP) channels are heterooctamers found in multiple cell types.1 The channel is composed of a pore-forming unit, Kir6.x, and a regulatory subunit, the sulfonylurea receptor (SUR). KATP channels are sensitive to intracellular energetic changes and are inhibited by ATP and stimulated by MgADP.2 The electrophysiological and pharmacological properties of KATP channels vary from tissue to tissue depending on the expression pattern of the specific Kir6.x and SUR subunits that constitute the channel. Biophysical profiles of KATP channels in native cells and tissues have been compared with heterologously expressed Kir6.x and SUR subunits to understand the composition of KATP channels in different tissues. For example, heterologous expression of Kir6.2 and SUR1 generates channels with a signature that closely matches the characteristics of native pancreatic -cell and neuronal KATP channels.
In the cardiovascular system, Kir6.2 and SUR2 constitute the major KATP channels of the heart reflecting expression in cardiomyocytes.1 SUR2 undergoes alternative splicing,3,4 where either exon 39 or exon 40 encodes the cytoplasmic carboxy terminus. SUR2 with exon 39 (SUR2A, also known as SUR2(39)) is found in cardiomyocytes and skeletal myofibers.5 In cardiomyocytes, KATP channels are quiescent at baseline and are activated by hypoxic or ischemic insults. The resultant potassium flux leads to a shortening of the action potential duration and cellular protection.6eC8 In addition to this role, KATP channels have been implicated in ischemic preconditioning,9eC12 the process where short bouts of ischemia before an index ischemic event activates intracellular signals and a transcriptional gene program that confers cellular protection. KATP channels are also involved in the normal cardiac response to adrenergic stress.13
In smooth muscle, including vascular smooth muscle, an alternatively spliced form of SUR2 that contains exon 40 (SUR2B, also known as SUR2(40)) is present. SUR2A and SUR2B differ in the carboxy-terminal 42 amino acids. Heterologous expression of SURB along with Kir6.1 results in a small-conductance, glibenclamide-sensitive potassium channel that is relatively insensitive to ATP, resembling the channel found in native vascular smooth muscle cells.14 These channels have been implicated in the regulation of resting coronary tone. Vascular KATP channels have also been implicated in the coronary vasodilatory response to exercise15 and hypoxia.16 KATP channels may also play a role in endotoxic vasodilation.17
Independent gene targeting studies in mice of either the gene encoding SUR2 (ABCC9) or Kir6.1 (KCNJ8) produced an identical phenotype of coronary artery spasm seen as transient ST segment elevation accompanied by atrioventricular heart block, bradycardia, and sudden death.18,19 As these genetically modified mice carried gene deletions that affected gene expression in all tissues, the origin of vascular spasm in Kir6.1 and SUR2 null mice was believed to result from of a loss of coronary artery vascular smooth muscle KATP channels, the common and overlapping cell type affected by both gene targeted mutants. To test the hypothesis that coronary artery smooth muscle KATP channels are responsible for the coronary artery spasm and sudden death seen in Kir6.1 and SUR2 null mice, we used the SM22 promoter to express SUR2B in SUR2eC/eC mice. Despite expression and reconstitution of vascular KATP channels, the phenotype of ST segment elevation and coronary artery vasospasm persisted, consistent with a vascular smooth muscle cell extrinsic mechanism of vascular spasm.
Materials and Methods
Transgenic Construct
The 2B isoform of SUR2 (SUR2B) was amplified from a mouse heart cDNA library and placed between the terminal 441 base pairs (bp) of the SM22 promoter20 and the bovine growth hormone termination and polyadenylation signal sequence. The plasmid (SM22-SUR2B) was verified by sequencing, digested, separated from the plasmid backbone, and purified before injection into fertilized oocytes.
Animals
SUR2eC/eC mice were described previously.19,21 The SUR2 mutant allele was bred heterozygously into the FVB background. The SM22-SUR2B transgene was injected into fertilized oocyte pronuclei generated from a cross between SUR2eC/eC females and FVB wild-type males (The Jackson Laboratory, Bar Harbor, Me). Transgene copy number was assessed by quantitative PCR using genomic DNA conducted in triplicate using transgene-specific primers with fold changes normalized to the apolipoprotein B reverse-transcribed transcript. Two transgene-positive SUR2+/eC founders were selected and independently mated to SUR2eC/eC and SUR2+/+ mice. Animals were housed, treated, and handled in accordance with the guidelines set forth by the University of Chicago’s Institutional Animal Care and Use Committee, the Animal Welfare Act regulations, and the NIH Guide for the Care and Use of Laboratory Animals. All comparisons were made to littermates. All studies were performed on male mice between 8 and 12 weeks of age unless otherwise noted.
Reverse-Transcription PCR
Total RNA was extracted from homogenized descending aortae using TRIzol reagent according to the protocol of the manufacturer (Invitrogen, Carlsbad, Calif). RNA pellets were resuspended in diethylpyrocarbonate-treated water and DNase treated (Turbo DNAfree, Ambion, Austin, Tex). Complementary DNA was synthesized using Superscript III reverse transcriptase (Invitrogen). Transgene-specific primers were used to detect products from the SM22-SUR2B transgene (SM22 promoter forward: 5' AGACACCGAAGCTACTCTCC 3', SUR2 exon 4 reverse: 5' GCGGAAGGCATCGTTTCAGA 3'; SUR2 exon 38 forward: 5' AGTCATGACAGCCTTTGCGG 3', BGH terminator reverse: 5' GCCTTCTAGTTGCCAGCCAT 3').
Cell Isolation and Electrophysiology
Aortic smooth muscle cells were isolated as previously described.22 Purity of the isolation for smooth muscle was ascertained on a subset of cells by immunofluorescence staining with an antieCsmooth muscle -actin antibody (Sigma-Aldrich, St Louis, Mo), and cell viability was ascertained by Trypan blue dye exclusion (Sigma-Aldrich). Only cells displaying the typical spindle-shape of smooth muscle by phase-contrast microscopy were used in patch-clamp experiments.
Conventional patch-clamp whole cell recording was performed at 20°C to 22°C.23 Axopath 200B amplifier and pClamp version 9.0 software (Axon Instruments Incorporated, Union City, Calif) were used. Patch pipettes were drawn from borosilicate glass (World Precision Instruments Incorporated, Sarasota, Fl) with a resistance of 2 to 3 M when filled with recording solutions. The bath solution contained 4 mmol/L KCl, 140 mmol/L NaCl, 10 mmol/L HEPES, 1 mmol/L CaCl2, 10 mmol/L glucose, 1.2 mmol/L MgCl2, and 50 eol/L nifedipine, pH 7.4, with KOH. Nifedipine was added to the bath solution to block the L-type Ca2+ current. The pipette solution was composed of 140 mmol/L KCl, 20 mmol/L HEPES, 5 mmol/L EGTA, 2 mmol/L MgCl2, 1 mmol/L UDP, pH 7.25, with KOH. To ensure the opening of 2 types of KATP channels reported in smooth muscle cell,3,14 ATP was omitted and Mg2+ and UDP included in the pipette. The whole cell current was generated by clamp pulses from a holding potential of eC70 mV to voltages ranging from eC120 to 20 mV in 20-mV steps for 260 ms. The currents were filtered at 1 kHz and sampled at 5 kHz. Data were digitally stored for off-line analysis using the pClamp software. Whole cell currents usually reached maximal levels 2 minutes after membrane rupture. Extracellular application of pinacidil 200 eol/L (Parke Davis, Ann Arbor, Mich) could not further increase the current amplitude. The whole cell current could be partially blocked by 20 eol/L glibenclamide (Sigma-Aldrich). The glibenclamide-sensitive current was interpreted as KATP current19 and was normalized by cell capacitance to obtain the whole cell current density.
Antibodies
An anti-SUR2 antibody, BNJ-2, was raised in rabbits. The peptide sequence QSKPINRKQPGRYH was conjugated to KLH before use as an antigen. This sequence falls within nucleotide binding fold 1. BNJ-2 was affinity purified using the antigenic peptide. The specificity of this antibody was determined by heterologous expression (data not shown). The monoclonal antieCsmooth muscle -actin antibody was from Sigma-Aldrich (catalog number A5228). Secondary antibodies included goat anti-mouse Alexa488 and goat anti-rabbit Alexa596 (Invitrogen). Primary antibodies were diluted to 1:8000 and 1:300 for BNJ-2 and the antieCsmooth muscle -actin, respectively. Secondary antibodies were diluted to 1:2000 and 1:6000 for Alexa488 and Alexa596, respectively.
Immunofluorescence Microscopy
Hearts were frozen in liquid nitrogeneCcooled isopentane, sectioned at a thickness of 8 e and fixed in eC20°C methanol for 10 minutes. Hearts were sectioned from base to apex and a minimum of every tenth section was examined for the presence of arteries using the antieCsmooth muscle -actin antibody to confirm the presence of arteries. Fluorescent images were viewed and captured using the Axioskop, AxioCam, and AxioVision microscope, camera, and software systems (Carl Zeiss Inc, Oberkochen, Germany).
Ambulatory Electrocardiographic Recordings
Continuous ambulatory electrocardiographic (ECG) recordings were obtained as described previously.19 Recording was begun after a 24-hour recovery period for 48 hours. ECG tracings were manually analyzed for spontaneous ST segment changes. ST segment frequency and duration during the first 2 hours of recording were quantified by an investigator blinded to mouse genotype. Heart rate variability was calculated as the SD of the mean R-R intervals over the recording period.
Microvascular Filling
Coronary artery microvascular filling was performed as described previously.19 Hearts were examined blinded to age, genotype, and animal number. Vessels found to be filled with Microfil were scored for presence or absence of focal narrowings, representing areas of focal vasospasm.
Coronary Perfusion Pressure
Mice were heparinized (0.5 U/g body weight) and anesthetized (inhaled 3% isoflurane). The hearts were then rapidly excised and transfused via a 24-gauge cannula (Fine Science Tools, Foster City, Calif) placed immediately distal of the intact aortic valve. Hearts were perfused at constant flow (&4.5 mL/min) with KrebseCHenseleit solution (in mmol/L: 120 NaCl, 4.7 KCl, 1.2 MgSO4, 1.2 KH2PO4, 15 glucose, 25 NaHCO3, 1.75 CaCl2, 0.05 EDTA) equilibrated with 95% O2 and 5% CO2 at 37°C using a standard Langendorff setup (Radnoti Glass Technology, Monrovia, Calif). Coronary perfusion pressure was continuously recorded using a pressure-sensing catheter (Millar Instruments, Houston, Tex) connected to the perfusion cannula. Hearts were equilibrated for at least 20 minutes before exposure to methylergonovine (10 eol/L, Sigma-Aldrich, catalog no. M2776) for 20 minutes. Hearts were maintained at 37°C via a water-jacketed tissue-organ bath for the duration of the experiment (N=3 in each group).
Statistical Analysis
All quantified results are reported as mean±SD unless otherwise noted. A Student’s t test was used to compare means where appropriate. A cutoff probability value of 0.05 was used unless otherwise noted. For coronary perfusion pressure measurements, a 1-way ANOVA followed by NewmaneCKeuls multiple comparison tests was used.
Results
Smooth Muscle Restricted Expression of SUR2B
We generated mice carrying a transgene to drive expression of SUR2B, the dominant isoform found in vascular smooth muscle, in coronary arteries using the SM22 promoter and following a strategy we had used previously (Figure 1A).24 The terminal 3' end of the SM22 promoter has been shown to be necessary and sufficient to drive expression specifically in arterial smooth muscle cells20,25 from mid-embryogenesis through adulthood.26 Mice harboring the SM22-SUR2B transgene were subsequently bred to mice with the null allele of SUR2 to produce mice with restoration of coronary artery vascular smooth muscle KATP channels.
Two independent SM22-SUR2B transgenic lines were generated and examined. Line 8 had a copy number of 3, and line 14 had a copy number of 12. Founder mice and their progeny were viable and fertile. The presence of mRNA produced from the SM22-SUR2B transgene was determined by RT-PCR of total RNA prepared from aortae (Figure 1B). Protein expression from the SM22-SUR2B transgene was documented by immunostaining using a rabbit polyclonal antibody raised against a region of the first nucleotide binding fold of SUR2 (Figure 2). Specificity of this BNJ-2 antibody was shown by its reactivity to normal coronary arteries and cardiomyocytes and its lack of reactivity to coronary arteries and cardiomyocytes in SUR2 null hearts (Figure 2). SUR2 immunoreactivity was seen consistently in both large and small vessels throughout the heart. Costaining with an antieCsmooth muscle -actin antibody was used to document the identity of coronary arteries and consistently appeared with SUR2 immunoreactivity as shown in Figure 2.
Restoration of Vascular Smooth Muscle KATP Channel Activity
Transgene-driven KATP channel activity was documented using whole cell patch clamp of isolated aortic vascular smooth muscle cells from SUR2 null mice with and without the SM22-SUR2B transgene. Cells isolated from both transgenic lines exhibited pinacidil-evocable, glibenclamide-sensitive currents, consistent with the known pharmacological characteristics of native KATP channels (Figure 3A). Whole cell current density in both lines was not statistically different from wild type (Figure 3B), consistent with the generation of the appropriate channel density within arterial smooth muscle.
Coronary Artery KATP Channel Activity Fails to Correct Coronary Artery Vascular Spasm
We examined SUR2 null mice with and without the SM22-SUR2B transgene for the presence of coronary artery vascular spasm using radiofrequency ambulatory monitoring. SUR2 null mice display frequent and repeated episodes of transient ST segment elevation that frequently associate with atrioventricular heart block and occasionally bradycardia, agonal rhythms, and death. Surprisingly, transgene-restored SM22-SUR2B/SUR2 null mice also displayed frequent, transient ST segment elevation indistinguishable from that seen in SUR2 null mice (Figure 4). After 48 hours of ambulatory ECG recording, SM22-SUR2B/SUR2eC/eC mice were compared with their SUR2eC/eC littermate controls. No statistically significant difference in mean heart rate (Figure 5A) or heart rate variability (Figure 5B) was seen between the groups. In mice surviving through the recording period, mean PR and QRS interval duration were not different between SM22-SUR2B/SUR2eC/eC mice and their SUR2eC/eC littermate controls (data not shown). Quantitation of these episodes revealed no statistically significant difference in the amount and duration of ST segment elevation between SM22-SUR2B/SUR2eC/eC mice and SUR2 null mice (Figure 5C). We also examined whether the presence of the transgene alone, in a wild-type background, was sufficient to produce ST segment elevation. We monitored the heart rates of animals from line 8 and found no evidence of ST segment elevation or other ECG abnormalities.
Evidence of Persistent Coronary Vasospasm in Transgenic Mice
A microvascular filling technique was used to demonstrate arterial narrowing consistent with vascular spasm in SUR2 null mice.24 Because ECG evidence of vasospasm was documented in both lines of SM22-SUR2B/SUR2 null mice, we used this microvascular filling technique to examine transgene-restored mice for the presence of coronary artery vascular spasm. Microvascular evidence for coronary spasm was documented in both transgene-restored lines as well (Figure 6A).
We also examined coronary perfusion pressure in littermate control as well as SUR2 null mice with and without the SM22-SUR2B transgene. The mean baseline coronary perfusion pressure in control mice (n=3) was 69±5 mm Hg. SUR2 null mice with and without the SM22-SUR2B transgene exhibited elevated baseline coronary perfusion pressures of 111±3 and 115±7 mm Hg, respectively, significantly higher than control mice (Figure 6B). Methylergonovine treatment (10 eol/L) of control mice induced a mild, insignificant increase in coronary perfusion pressure to 79±2 mm Hg. In contrast, methylergonovine produced statistically significant increases of coronary perfusion pressure in SUR2 null mice with and without the SM22-SUR2B transgene (137±5 and 147±13 mm Hg, respectively). These data directly demonstrate that coronary artery perfusion pressure at baseline and in response to methylergonovine remained functionally abnormal despite restoration of arterial vascular SUR2-KATP channels.
Discussion
Here we show a persistent phenotype of coronary artery vascular spasm in mice engineered to lack SUR2 despite restoration of vascular smooth muscle KATP channels. Smooth muscle restoration of coronary artery KATP channels was ineffective in reducing spasm and the consequent atrioventricular heart block and sudden death that accompanies this spasm. These findings indicated that coronary artery vascular spasm associated with global loss of SUR2-Kir6.1 KATP channels arises from a vascular smooth muscle celleCextrinsic process. Although never directly tested, the etiology of vasospasm in mice with targeted gene deletions of Kir6.1 or SUR2 had been attributed to the loss of KATP channels in smooth muscle.18,19 The presumed role of the vascular smooth muscle etiology was surmised based on the overlapping patterns of expression of these genes; both Kir6.1 and SUR2 are found in vascular smooth muscle. Considerable evidence suggests that the smooth muscle KATP channel is composed of Kir6.1 and SUR2B.3,14 However, it should be noted that both subunits are coexpressed in other cell types such as endothelial27eC29 and neuronal cell types.30eC33 Although not the dominant KATP channel, low-level expression is also present in cardiomyocytes.18,28,34
Mice lacking SUR2 do not show the normal vascular reactivity to glibenclamide and pinacidil, supporting a role for SUR2-KATP channels in the regulation of vascular tone.19 Our current studies have focused on expression of SUR2 in coronary artery vascular smooth muscle and in aortic smooth muscle because the SM22 promoter drives expression in these tissues. However, despite functional expression in these tissues, evidence for coronary artery spasm and increased coronary artery perfusion pressure remained. There is evidence to support a role for endothelial KATP channels in vascular function and, potentially, in the regulation of vascular tone and vascular spasm. Adenosine35 and 2-adrenergic36 vasodilatation may be dependent on endothelial KATP channels. However, in the rat aorta, vasodilation induced by opening of KATP channels was not affected by endothelial denudation, indicating that other mechanisms may be sufficient to override endothelial control.
Neuronal KATP channels may also contribute to vasospasm and sudden death seen in SUR2 null mice. The ability of the autonomic nervous system to induce coronary spasm has been documented,37,38 and a role for autonomic hyperactivity in human variant angina has been postulated.39 Blockade of KATP channels was shown to augment the normal increase in coronary vascular resistance seen with sympathetic nerve stimulation.40 This effect may be mediated by an unopposed neuropeptide Y effect.41 More recently, it has been proposed that the attenuation of cardiac norepinephrine overflow seen during low-flow ischemia may be mediated in part by the opening of presynaptic KATP channels.42 In skeletal muscle, the normal contraction-induced attenuation of sympathetic vasoconstriction is partially abolished by inhibition of KATP channels.43 These studies point to a possible role of the pre-synaptic KATP channel of sympathetic neurons in the etiology of coronary spasm.
Our studies demonstrate that spontaneous coronary artery vasospasm seen in mice lacking SUR2 arises from a vascular smooth muscleeCextrinsic process. This surprising finding suggests that the loss of KATP channels in an organ system in close interaction with the coronary vasculature is vital for normal coronary function as studies in isolated hearts showed evidence of abnormal vascular reactivity, eliminating more distant regulators of vascular tone. A precedent for the involvement of KATP channels in tissue and organ system crosstalk has recently been noted in the central nervous system. Hypothalamic KATP channel function affects systemic glucose homeostasis indirectly by altering pancreatic -cell glucagon secretion44 and hepatic gluconeogenesis.33 It is possible that the normal, KATP-mediated regulation of cardiovascular function may also be controlled though multiorgan system or, more likely, a proximal paracrine effect mediated by the neuronal or endothelial crosstalk to vascular smooth muscle.
Acknowledgments
This work was supported by the Burroughs Wellcome Fund (to E.M.M.), NIH grant HL078926 (to E.M.M.), and NIH grant HL057414 (to J.C.M.). R.K. was supported by NIH grant 5T32HL007381. B.Y. was supported by American Heart Association national scientist development grant 0435030N.
References
Seino S, Miki T. Physiological and pathophysiological roles of ATP-sensitive K+ channels. Prog Biophys Mol Biol. 2003; 81: 133eC176.
Noma A. ATP-regulated K+ channels in cardiac muscle. Nature. 1983; 305: 147eC148.
Isomoto S, Kondo C, Yamada M, Matsumoto S, Higashiguchi O, Horio Y, Matsuzawa Y, Kurachi Y. A novel sulfonylurea receptor forms with BIR (Kir6.2) a smooth muscle type ATP-sensitive K+ channel. J Biol Chem. 1996; 271: 24321eC24324.
Chutkow WA, Simon MC, Le Beau MM, Burant CF. Cloning, tissue expression, and chromosomal localization of SUR2, the putative drug-binding subunit of cardiac, skeletal muscle, and vascular KATP channels. Diabetes. 1996; 45: 1439eC1445.
Inagaki N, Gonoi T, Clement JP, Wang CZ, Aguilar-Bryan L, Bryan J, Seino S. A family of sulfonylurea receptors determines the pharmacological properties of ATP-sensitive K+ channels. Neuron. 1996; 16: 1011eC1017.
Faivre JF, Findlay I. Action potential duration and activation of ATP-sensitive potassium current in isolated guinea-pig ventricular myocytes. Biochim Biophys Acta. 1990; 1029: 167eC172.
Nichols CG, Ripoll C, Lederer WJ. ATP-sensitive potassium channel modulation of the guinea pig ventricular action potential and contraction. Circ Res. 1991; 68: 280eC287.
Findlay I. The ATP sensitive potassium channel of cardiac muscle and action potential shortening during metabolic stress. Cardiovasc Res. 1994; 28: 760eC761.
Cohen MV, Baines CP, Downey JM. Ischemic preconditioning: from adenosine receptor of KATP channel. Annu Rev Physiol. 2000; 62: 79eC109.
Gross GJ, Peart JN. KATP channels and myocardial preconditioning: an update. Am J Physiol Heart Circ Physiol. 2003; 285: H921eCH930.
Suzuki M, Sasaki N, Miki T, Sakamoto N, Ohmoto-Sekine Y, Tamagawa M, Seino S, Marban E, Nakaya H. Role of sarcolemmal K(ATP) channels in cardioprotection against ischemia/reperfusion injury in mice. J Clin Invest. 2002; 109: 509eC516.
Gumina RJ, Pucar D, Bast P, Hodgson DM, Kurtz CE, Dzeja PP, Miki T, Seino S, Terzic A. Knockout of Kir6.2 negates ischemic preconditioning-induced protection of myocardial energetics. Am J Physiol Heart Circ Physiol. 2003; 284: H2106eCH2113.
Zingman LV, Hodgson DM, Bast PH, Kane GC, Perez-Terzic C, Gumina RJ, Pucar D, Bienengraeber M, Dzeja PP, Miki T, Seino S, Alekseev AE, Terzic A. Kir6.2 is required for adaptation to stress. Proc Natl Acad Sci U S A. 2002; 99: 13278eC13283.
Yamada M, Isomoto S, Matsumoto S, Kondo C, Shindo T, Horio Y, Kurachi Y. Sulphonylurea receptor 2B and Kir6.1 form a sulphonylurea-sensitive but ATP-insensitive K+ channel. J Physiol. 1997; 499 (pt 3): 715eC720.
Ishibashi Y, Duncker DJ, Zhang J, Bache RJ. ATP-sensitive K+ channels, adenosine, and nitric oxide-mediated mechanisms account for coronary vasodilation during exercise. Circ Res. 1998; 82: 346eC359.
Kingsbury MP, Robinson H, Flores NA, Sheridan DJ. Investigation of mechanisms that mediate reactive hyperaemia in guinea-pig hearts: role of K(ATP) channels, adenosine, nitric oxide and prostaglandins. Br J Pharmacol. 2001; 132: 1209eC1216.
Landry DW, Oliver JA. The ATP-sensitive K+ channel mediates hypotension in endotoxemia and hypoxic lactic acidosis in dog. J Clin Invest. 1992; 89: 2071eC2074.
Miki T, Suzuki M, Shibasaki T, Uemura H, Sato T, Yamaguchi K, Koseki H, Iwanaga T, Nakaya H, Seino S. Mouse model of Prinzmetal angina by disruption of the inward rectifier Kir6.1. Nat Med. 2002; 8: 466eC472.
Chutkow WA, Pu J, Wheeler MT, Wada T, Makielski JC, Burant CF, McNally EM. Episodic coronary artery vasospasm and hypertension develop in the absence of Sur2 K(ATP) channels. J Clin Invest. 2002; 110: 203eC208.
Solway J, Seltzer J, Samaha FF, Kim S, Alger LE, Niu Q, Morrisey EE, Ip HS, Parmacek MS. Structure and expression of a smooth muscle cell-specific gene, SM22 alpha. J Biol Chem. 1995; 270: 13460eC13469.
Chutkow WA, Samuel V, Hansen PA, Pu J, Valdivia CR, Makielski JC, Burant CF. Disruption of Sur2-containing K(ATP) channels enhances insulin-stimulated glucose uptake in skeletal muscle. Proc Natl Acad Sci U S A. 2001; 98: 11760eC11764.
Ray JL, Leach R, Herbert JM, Benson M. Isolation of vascular smooth muscle cells from a single murine aorta. Methods Cell Sci. 2001; 23: 185eC188.
Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch. 1981; 391: 85eC100.
Wheeler MT, Allikian MJ, Heydemann A, Hadhazy M, Zarnegar S, McNally EM. Smooth muscle cell-extrinsic vascular spasm arises from cardiomyocyte degeneration in sarcoglycan-deficient cardiomyopathy. J Clin Invest. 2004; 113: 668eC675.
Li L, Miano JM, Mercer B, Olson EN. Expression of the SM22alpha promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and visceral smooth muscle cells. J Cell Biol. 1996; 132: 849eC859.
Moessler H, Mericskay M, Li Z, Nagl S, Paulin D, Small JV. The SM 22 promoter directs tissue-specific expression in arterial but not in venous or visceral smooth muscle cells in transgenic mice. Development. 1996; 122: 2415eC2425.
Yoshida H, Feig JE, Morrissey A, Ghiu IA, Artman M, Coetzee WA. K ATP channels of primary human coronary artery endothelial cells consist of a heteromultimeric complex of Kir6.1, Kir6.2, and SUR2B subunits. J Mol Cell Cardiol. 2004; 37: 857eC869.
Morrissey A, Rosner E, Lanning J, Parachuru L, Dhar Chowdhury P, Han S, Lopez G, Tong X, Yoshida H, Nakamura TY, Artman M, Giblin JP, Tinker A, Coetzee WA. Immunolocalization of KATP channel subunits in mouse and rat cardiac myocytes and the coronary vasculature. BMC Physiol. 2005; 5: 1.
Schnitzler MM, Derst C, Daut J, Preisig-Muller R. ATP-sensitive potassium channels in capillaries isolated from guinea-pig heart. J Physiol. 2000; 525 (pt 2): 307eC317.
Sakura H, Ammala C, Smith PA, Gribble FM, Ashcroft FM. Cloning and functional expression of the cDNA encoding a novel ATP-sensitive potassium channel subunit expressed in pancreatic beta-cells, brain, heart and skeletal muscle. FEBS Lett. 1995; 377: 338eC344.
Zhou M, Tanaka O, Sekiguchi M, Sakabe K, Anzai M, Izumida I, Inoue T, Kawahara K, Abe H. Localization of the ATP-sensitive potassium channel subunit (Kir6. 1/uK(ATP)-1) in rat brain. Brain Res Mol Brain Res. 1999; 74: 15eC25.
Thomzig A, Pruss H, Veh RW. The Kir6.1-protein, a pore-forming subunit of ATP-sensitive potassium channels, is prominently expressed by giant cholinergic interneurons in the striatum of the rat brain. Brain Res. 2003; 986: 132eC138.
Pocai A, Lam TK, Gutierrez-Juarez R, Obici S, Schwartz GJ, Bryan J, Aguilar-Bryan L, Rossetti L. Hypothalamic K(ATP) channels control hepatic glucose production. Nature. 2005; 434: 1026eC1031.
Pountney DJ, Sun ZQ, Porter LM, Nitabach MN, Nakamura TY, Holmes D, Rosner E, Kaneko M, Manaris T, Holmes TC, Coetzee WA. Is the molecular composition of K(ATP) channels more complex than originally thought J Mol Cell Cardiol. 2001; 33: 1541eC1546.
Kuo L, Chancellor JD. Adenosine potentiates flow-induced dilation of coronary arterioles by activating KATP channels in endothelium. Am J Physiol. 1995; 269: H541eCH549.
Gendron ME, Thorin E, Perrault LP. Loss of endothelial KATP channel-dependent, NO-mediated dilation of endocardial resistance coronary arteries in pigs with left ventricular hypertrophy. Br J Pharmacol. 2004; 143: 285eC291.
Cohen RA. Platelet-induced neurogenic coronary contractions due to accumulation of the false neurotransmitter, 5-hydroxytryptamine. J Clin Invest. 1985; 75: 286eC292.
Cohen RA. Role of autonomic nerves and endothelium in coronary vasospasm. Prog Clin Biol Res. 1986; 219: 353eC362.
Yasue H, Touyama M, Shimamoto M, Kato H, Tanaka S. Role of autonomic nervous system in the pathogenesis of Prinzmetal’s variant form of angina. Circulation. 1974; 50: 534eC539.
Mori H, Chujo M, Tanaka E, Yamakawa A, Shinozaki Y, Mohamed MU, Nakazawa H. Modulation of adrenergic coronary vasoconstriction via ATP-sensitive potassium channel. Am J Physiol. 1995; 268: H1077eCH1085.
Tanaka E, Mori H, Chujo M, Yamakawa A, Mohammed MU, Shinozaki Y, Tobita K, Sekka T, Ito K, Nakazawa H. Coronary vasoconstrictive effects of neuropeptide Y and their modulation by the ATP-sensitive potassium channel in anesthetized dogs. J Am Coll Cardiol. 1997; 29: 1380eC1389.
Burgdorf C, Dendorfer A, Kurz T, Schomig E, Stolting I, Schutte F, Richardt G. Role of neuronal KATP channels and extraneuronal monoamine transporter on norepinephrine overflow in a model of myocardial low flow ischemia. J Pharmacol Exp Ther. 2004; 309: 42eC48.
Thomas GD, Hansen J, Victor RG. ATP-sensitive potassium channels mediate contraction-induced attenuation of sympathetic vasoconstriction in rat skeletal muscle. J Clin Invest. 1997; 99: 2602eC2609.
Miki T, Liss B, Minami K, Shiuchi T, Saraya A, Kashima Y, Horiuchi M, Ashcroft F, Minokoshi Y, Roeper J, Seino S. ATP-sensitive K+ channels in the hypothalamus are essential for the maintenance of glucose homeostasis. Nat Neurosci. 2001; 4: 507eC512
Vasospasm and p53-Induced Apoptosis in an Experimental Model of Subarachnoid Hemorrhage
Role of Endothelial NO Synthase Phosphorylation in Cerebrovascular Protective Effect of Recombinant Erythropoietin During Subarachnoid Hemorrhage– Induced Cerebral Vasospasm
Simvastatin Reduces Vasospasm After Aneurysmal Subarachnoid Hemorrhage
Effects of Acute Treatment With Pravastatin on Cerebral Vasospasm, Autoregulation, and Delayed Ischemic Deficits After Aneurysmal Subarachnoid Hemorrhage
Role of c-Jun N-Terminal Kinase in Cerebral Vasospasm After Experimental Subarachnoid Hemorrhage
Exercise Can Prevent and Reverse the Severity of Hypertrophic Cardiomyopathy
Interferon- Induces Major Histocompatibility Class II Transactivator (CIITA), Which Mediates Collagen Repression and Major Histocompatibility Class II Activation by Human Aortic Smooth Muscle Cells
Neurogenic Mechanisms Contribute to Hypertension in Mice With Disruption of the K-Cl Cotransporter KCC3
Upregulated TRPC1 Channel in Vascular Injury In Vivo and Its Role in Human Neointimal Hyperplasia
Elevated Homocysteine Reduces Apolipoprotein A-I Expression in Hyperhomocysteinemic Mice and in Males With Coronary Artery Disease