您的位置: 百康网 > 期刊 > 内科学 > 《循环研究杂志》 > 2005年10月第10期 > 正文
Activation of the Sphingosine KinaseeCSignaling Pathway by High Glucose Mediates the Proinflammatory Phenotype of Endothelial Cells
http://www.100kang.com 2007-5-8 22:15:00 Cells


    The Signal Transduction Laboratory (L.W., A.H., C.W., J.R.G., M.A.V., P.X.), Division of Human Immunology, Hanson Institute, Institute of Medical and Veterinary Science, Adelaide, Australia
    Department of Medicine (J.R.G., M.A.V., P.X.), University of Adelaide, Australia
    Department of Endocrinology (X.-P.X.), Peking Union Medical College Hospital, Beijing, China.

    Abstract

    Vascular endothelial cells are key targets for hyperglycemic damage that facilitates vascular inflammation and the vasculopathy associated with diabetes mellitus. However, the mechanisms underlying this damage remain undefined. We now demonstrate that hyperglycemia induces activation of sphingosine kinase (SphK), which represents a novel signaling pathway that mediates endothelial damage under ambient high glucose conditions. SphK activity was significantly increased in aorta and heart of streptozotocin-induced diabetic rats. Interestingly, this increase in SphK activity was prevented by insulin treatment, which achieved euglycemia in the diabetic animals. Hyperglycemia-induced increase in SphK activity was also evident in endothelial cells that received long-term exposure to high glucose (22 mmol/L). Studies using a small interfering RNA strategy demonstrated that endogenous SphK1, but not SphK2, is the major isoenzyme that was activated by high glucose. In addition, an increase in SphK1 phosphorylation was detected in a protein kinase CeC and extracellular signaleCregulated kinase 1/2eCdependent manner, which accounts for the high glucoseeCinduced increases in SphK activity. Importantly, inhibition of SphK1 by either a chemical inhibitor (N',N'-dimethylsphingosine) or expression of a dominant-negative mutant of SphK1 (SphKG82D), or SphK1-specific small interfering RNA, strongly protected endothelial cells against high glucoseeCinduced damage, as characterized by an attenuation in the expression of proinflammatory adhesion molecules, adhesion of leukocytes to endothelial cells, and nuclear factor B activation. Thus, interventions that target the SphK-signaling pathway may have the potential to prevent vascular lesions under hyperglycemic conditions.

    Key Words: diabetes  endothelial cells  hyperglycemia  sphingosine kinase  vascular inflammation

    Introduction

    Chronic hyperglycemia is now recognized as a major etiological factor causing both micro- and macrovascular lesions associated with diabetes mellitus, including coronary, cerebrovascular, and peripheral atherosclerotic disease.1,2 One of the reported cellular mechanisms by which hyperglycemia damages the vasculature is via an upregulation of cell-surface adhesion molecule expression by endothelial cells (EC),3,4 a hallmark of EC activation. Such cellular responses facilitate adhesion and transmigration of leukocytes across the endothelium, leading to vascular inflammation and, hence, contributing to the initiation and progression of diabetic vascular diseases.5 Despite hyperglycemia-induced EC activation being verified at both in vitro and ex vivo levels,6,7 the precise molecular mechanism by which this phenomenon occurs remains undefined. However, the observation that the proinflammatory cytokines (such as tumor necrosis factor [TNF]-), known to be elevated in diabetic patients, especially whose with vascular complications,8,9 also cause EC activation similar to that induced by hyperglycemia may provide an insight into the potential mechanism.

    We have previously reported that sphingosine 1-phosphate (S1P), together with the enzyme responsible for its formation, sphingosine kinase (SphK), plays a critical role in mediating EC activation and induction of adhesion molecules in response to TNF- stimulation.10 There is now ample evidence demonstrating that SphK/S1P is an important signal mediator in the regulation of EC function, including cell survival, proliferation, migration, and angiogenesis.11eC13 Especially relevant in this regard is the dual action of S1P, a lipid known to function both extra- and intracellularly. Extracellularly, S1P derived from activated platelets or other cells14 acts via a family of G proteineCcoupled receptors, including S1P1 to 4 and S1P5, on the surface of EC, leading to activation of phospholipase D, focal adhesion kinase, Ras, Rac, and Rho GTPase.11 S1P has also been suggested to act as a second messenger participating in intracellular signaling cascades, such as calcium mobilization, extracellular signaleCregulated kinase (ERK), and nuclear factor (NF)-B activation.12 Such diverse and vital biological effects of S1P reveal a critical signaling role of S1P and, thus, of SphK in vascular biology. In the current study, we have demonstrated at both in vitro and in vivo levels that chronic hyperglycemia was capable of activating SphK, specifically, SphK1. Illustrating its functional importance, we have shown that the activation of the SphK-signaling pathway was critically involved in hyperglycemia-induced endothelial activation and the proinflammatory phenotype of EC.

    Materials and Methods

    Animals

    Male SpragueeCDawley rats weighing 270 to 290 g were housed in a room under controlled temperature conditions (22°C) and 12-hour/12-hour light/dark cycles. Diabetes was induced by a single IP injection of streptozotocin (STZ) (80 mg/kg; Sigma-Aldrich). Control rats were injected with an equivalent volume of the vehicle only. After injection (24 hour), diabetes was diagnosed by the development of hyperglycemia (>14 mmol/L blood glucose). One-half of the diabetic rats were randomly selected to receive insulin treatment (Linplant, 1 implant/200 g body weight; LinShin, Ontario, Canada). Blood glucose levels were monitored every 4 days using Glucostix reagent strips (Boehringer Mannheim, Indianapolis, Ind). Two weeks after onset of diabetes, rats were killed for the study. All experiments were conducted in accordance with the PC-2 Procedure of the Institute of Medical and Veterinary Science and approved by the Animal Ethics Committee of the institution.

    Cell Culture and Flow Cytometry Analysis

    Human umbilical vein EC (HUVEC) and bovine aortic EC (BAEC) were routinely cultured as previously described.15 In all experiments, EC ranging from passages 2 to 6 were used. For the experimental studies, EC were allowed to reach confluence in the regular growth media. Medium was then changed to: (1) Eagle’s basal medium (Clonetics, Walkersville, Md) containing 1% FCS and 5.5 mmol/L glucose (normal glucose [NG]); (2) NG medium supplemented with additional glucose to a final concentration of 22 mmol/L (high glucose); or (3) NG medium containing 16.5 mmol/L L-glucose or mannitol. The expression of cell-surface adhesion molecules (vascular cell adhesion molecule [VCAM]-1, intercellular cell adhesion molecule [ICAM]-1, and E-selectin) was measured by flow cytometry analysis using a Coulter Epics Profile XL flow cytometer, as described previously.10

    Plasmids, Small Interfering RNA, and Transfection

    FLAG-tagged human wild-type SphK1 cDNA and the dominant negative SphK1 (SphKG82D) were sub-cloned into pcDNA3 plasmids (Invitrogen, Melbourne, Australia) as previous described.16 Chemical synthesized small interfering (siRNA) duplexes with 3'-fluorescein modification were purchased from Qiagen-Xeragon (Germantown, Md). The siRNA-targeted sequences were: AAGAGCTGCAAGGCCTTGCCC (SphK1), AACCTCATCCAGACAGAACGA (SphK2), and AATTCTCCGAACGTGTCACGT (for a scrambled control siRNA). Transfection mediated by Lipofectamine 2000 (Invitrogen) or TransPass R2 (BioLabs) was performed in EC according to the protocols of the manufacturer.

    Assays of SphK Activity and S1P Formation

    As described previously,10 SphK activity was routinely determined using D-erythro-sphingosine (Biomol, Plymouth Meeting, Pa) and [32P]ATP (Geneworks, Adelaide, Australia) as substrates and defined as picomoles of S1P formed per minute per milligram of protein. The formation of S1P in vivo was measured in the permeabilized cells as previously described.17

    Protein Kinase C Activity Assay

    Cells were seeded in 24-well plates and exposed to the indicated treatments. Total protein kinase C (PKC) activity was then determined in permeabilized cells incubated with [32P]ATP (10 eol/L, 5000 cpm/pmol) and the PKC-specific peptide substrate (RKRTLRRL) as described previously.18 The activity was quantified by scintillation counting and normalized to total protein levels.

    Adherence of U937 Cells to EC

    EC were seeded into 24-well plates and cultured with the indicated conditions. After washing the U937, cell suspension (104 cells/well) was added on the monolayers of EC and incubated for 30 minutes at 37°C. Nonadherent cells were removed by rinsing the plates 3 times, and the number of adherent cells was then counted under microscopy with at least 6 fields per well culture being quantified.

    Electrophoretic Mobility Shift Assay

    Nuclear extracts were prepared from EC with the indicated treatment. The probe of double-stranded oligonucleotides used was 5'-GGATGCCATTGGGGATTTCCTCTTTACTGGATGT-3', which contains a consensus NF-B binding site (underlined) in E-selectin promoter. Gel mobility shift of a consensus NF-B oligonucleotide was performed by incubating a 32P-labeled NF-B probe with 4 e of nuclear proteins as described previously.10 The specific DNAeCprotein complexes were completely abolished by addition of a 50-fold molar excess of unlabeled E-selectin NF-B oligonucleotides.

    Statistical Analysis

    Data are expressed as mean±SEM, and n indicates the number of experiments. Unpaired Student t tests were used for comparison between 2 groups. For multiple comparisons, results were analyzed by ANOVA followed by the Dunnet test. A value of P<0.05 was considered statistically significant.

    Results

    Effect of Hyperglycemia on SphK Activity in STZ-Induced Diabetic Rats

    To examine whether SphK is involved in hyperglycemic damage on vasculature, SphK activity in vascular tissues from STZ-induced diabetic rats was measured 2 weeks after onset of diabetes. As shown in Figure 1, SphK activity was significantly increased by 42% (P<0.05) in the aorta and 68% (P<0.01) in the heart of diabetic rats compared with samples taken from control animals. The institution of glycemic control with the use of an insulin pump achieved near euglycemia within several hours, which correlated with a significant reduction in SphK activity in both the aorta and heart from diabetic rats (Figure 1), suggesting that the increased SphK activity is likely attributable to hyperglycemia.

    Effects of High Glucose on SphK Activity in EC

    To confirm the potential effect of hyperglycemia on SphK activity, established cell-culture models were used. HUVEC or BAEC cultured in high glucose (22 mmol/L) media for 3 days resulted in a 60% and 70% increase in SphK activity, respectively, compared with the cells cultured under NG conditions (P<0.01) (Figure 2A). Consistent with the increases in enzyme activity, intracellular S1P production was increased by &50% in both HUVEC and BAEC exposed to high glucose (Figure 2B). However, there was no significant change in SphK activity when cells were exposed to high glucose for <48 hours (data not shown), indicating that long-term exposure to high glucose is required for SphK activation in EC. Serving as a control, neither mannitol nor L-glucose at 22 mmol/L had any significant effects on SphK activity in HUVEC or BAEC, ruling out a possible influence of osmotic stress.

    High GlucoseeCInduced SphK Activity Mediates EC Activation

    Given the effect of high glucose on SphK activity in EC, we sought to determine the functional consequences of SphK activation induced by high glucose. In agreement with our previous report,15 exposure of HUVEC to high glucose for 3 days resulted in significant increases in the cell-surface expression of VCAM-1, ICAM-1, and E-selectin by 3.1-, 2.7-, and 4.2-fold, respectively (Figure 3A). Interestingly, high glucoseeCinduced increases in VCAM-1, ICAM-1, and E-selectin expression were completely abolished in the presence of N'N'-dimethylsphingosine (DMS), a specific inhibitor of SphK, at a concentration of 2.5 eol/L (Figure 3A). At this low concentration, DMS was capable of inhibiting high glucoseeCinduced SphK activity, whereas no inhibitory effect on PKC activity was detected (Figure 3B), which concurs with the previous report showing the specificity of inhibition by DMS.19 Collectively, these results suggest a critical involvement of SphK activity in EC activation that results from long-term high-glucose exposure.

    SphK Activation Is Required for the High GlucoseeCInduced Proinflammatory Phenotype of EC

    To further verify the role of SphK in mediating high glucoseeCinduced EC activation, BAEC were stably transfected with wild-type human SphK1 (SphKWT) or a point mutation of SphK1, SphKG82D. Despite SphKWT-transfected BAEC having a 10-fold higher basal level of SphK activity (Figure 4A), cells cultured with high glucose resulted in a further increase in SphK activity to a similar extent (&70%) to that seen in the parental cells or the cells transfected with empty vector alone. This indicates that the transgenes of SphK1 are functionally expressed in BAEC and are readily activated in response to high glucose. In contrast, no SphK activation was observed in the cells expressing SphKG82D under high glucose conditions (Figure 4A), confirming the dominant-negative role of SphKG82D in the transfected BAEC.

    Given the possible involvement of SphK in high glucoseeCinduced adhesion molecule expression as reported above, we then examined the interaction of EC with leukocytes to test a pathophysiological relevance of the phenomenon. In agreement with our previous report,15 high-glucose treatment resulted in a significant increase in the adherence of leukocytes to EC (Figure 4C). Interestingly, the number of leukocytes adhering to high glucoseeCstimulated BAEC was markedly enhanced by overexpression of SphKWT, whereas it was attenuated in the cells expressing SphKG82D (Figure 4C), further supporting a role for SphK activation in mediating the high glucoseeCinduced EC proinflammatory phenotype.

    SphK1 Is Responsible for the SphK-Mediated EC Activation Under High-Glucose Conditions

    As 2 human SphK isoforms (SphK1 and SphK2) exist, it is necessary to determine which isoform (or both) is involved in the high glucoseeCinduced SphK activity and EC activation. To this end, we used siRNA to specifically downregulate either SphK1 or SphK2 expression in HUVEC. Endogenous SphK1 or SphK2 levels were reduced by 81% or 78% following treatment with SphK1- or SphK2-specific siRNA, respectively (Figure 5A and 5B). The specificity of these siRNAs was demonstrated by their inability to inhibit the alternative isoform of SphK and the control gene, cyclophilin. High glucoseeCinduced increases in both SphK activity and adherence of leukocytes to EC were almost completely blocked by SphK1-specific siRNA (Figure 5C and 5D). Interestingly, SphK2-specific siRNA had no significant effect on the high glucoseeCinduced increases in either SphK activity or the adherence of leukocytes to EC, albeit the baseline SphK activity was decreased by the SphK2 siRNA (Figure 5). Taken together, these results not only indicate that SphK1 is most likely to be responsible for the high glucoseeCinduced increases in SphK activity but also suggest a key role for endogenous SphK1 in mediating EC activation under high glucose conditions.

    Effect of S1P Receptors on SphK-Mediated EC Activation

    The biological consequences of SphK activation rely on the production of S1P, which functions either extracellularly (ie, through S1P receptors) or intracellularly. To verify whether S1P receptors are involved in the SphK-mediated EC activation induced by high glucose, we used pertussis toxin (PTX), an inhibitor of Gi proteins, which has previously been shown to block the majority of S1P receptors in EC.21 As shown in Figure 6A, treatment of HUVEC with PTX resulted in only partial inhibition of the high glucoseeCinduced expression of VCAM-1, ICAM-1, and E-selectin by 30%, 42%, and 35%, respectively, in comparison with the untreated cells. The number of leukocytes adhering to the high glucoseeCstimulated EC was also partially reduced by PTX (Figure 6B). To further investigate a possible role for S1P receptors, we treated HUVEC with S1P, lysophosphatidic acid (LPA), or dihydro-S1P (sphinganine-1-phosphate), a S1P analogue that has no significant intracellular effects.22 S1P and LPA caused an increase in E-selectin expression to similar extents, whereas dihydro-S1P had no effect on E-selectin expression (Figure 6C). Interestingly, PTX completely inhibited LPA-induced E-selectin expression, although it only partially inhibited the effect of S1P (32%) (Figure 6C). Taken together, these results suggest that the intracellular effects of S1P may account chiefly for the SphK-dependent EC activation induced by high glucose.

    PKC and ERK1/2 Mediate High GlucoseeCInduced SphK Activation

    The ability of high glucose to activate PKC in EC has been well documented.23 Previous studies with HEK 293 cells have suggested a role for PKC in mediating SphK activation.24 We therefore examined a potential role for PKC in the high glucoseeCinduced SphK activation. As shown in Figure 7A, treatment of HUVEC with a PKC-specific inhibitor, GF109203X, resulted in a 50% attenuation of the high glucoseeCinduced increases in SphK activity. More recently, we have demonstrated that ERK1/2 were capable of directly activating SphK1 via the enzyme phosphorylation.25 Indeed, cells exposed to high glucose resulted in a significant increase in SphK1 phosphorylation (Figure 7B). Serving as a control, SphK1 was phosphorylated in response to phorbol 12-myristate 13-acetate stimulation in EC. In addition, treatment with GF109203X or specific inhibitors of the ERK1/2 signaling (PD98059 or U0126) almost completely prevented high glucoseeCinduced SphK1 phosphorylation and activation (Figure 7B), suggesting an important role for PKC and ERK1/2 in mediating SphK1 activation in EC exposed to high glucose.

    High GlucoseeCInduced NF-B Activation Is Dependent on SphK Activity

    High glucose has been shown to activate the transcription factor NF-B,3 which is a key transcriptional regulator of a number of proinflammatory genes, including adhesion molecules.26 Using electrophoretic mobility shift assays we showed that treatment of EC with high glucose resulted in a significant increase in NF-B DNA-binding activity (Figure 8). Remarkably, in the presence of the SphK-specific inhibitor DMS, high glucoseeCinduced NF-B activation was completely inhibited (Figure 8, lane 3). Furthermore, high glucose was incapable of activating NF-B in the BAEC stably expressing SphKG82D (Figure 8, lane 8). Serving as a control, SphKG82D had no effect on the S1P-induced NF-B activation (Figure 8, lane 9). Together, these data indicate an important role for SphK activity in EC to mediate high glucoseeCinduced NF-B activation.

    Discussion

    Activation of SphK has emerged as an important signal-transduction pathway in regulating a variety of physiological and pathophysiological processes, including vascular maturation, cardiac development, angiogenesis, and vascular inflammation (reviewed by Hla et al11 and Spiegel et al12). The present study, for the first time, demonstrates a potential role for SphK in mediating hyperglycemia-induced endothelial damage associated with diabetes. In STZ-induced diabetic rats, SphK activity was significantly increased in cardiovascular tissues (aorta and heart). When euglycemia was achieved with insulin treatment in the diabetic rats, the increased SphK activity was completely prevented, suggesting that the increased SphK activity was most likely attributable to hyperglycemia. This notion was further supported by the in vitro studies showing a direct effect of high glucose on SphK activation in vascular EC, whereas insulin itself has no inhibitory effect on the enzyme activity in vitro (data not shown). Incubation of either HUVEC or BAEC with long-term high-glucose exposure resulted in profound increases in not only SphK activity, but also production of S1P. Furthermore, the nonmetabolizable L-glucose or mannitol at 22mmol/L failed to activate SphK, indicating a specific effect of hyperglycemia, may principally be attributable to the surplus cellular metabolites of D-glucose within the cells.

    The recognition that inflammation within the vascular wall is present at all stages of atherosclerotic cardiovascular diseases including diabetic complications, has highlighted an essential role for EC activation in mediating this pathophysiological process.27 The induction of various EC-surface adhesion molecules is now well recognized as a key cellular phenomenon that initiates and facilitates vascular inflammation leading to the development of atherosclerotic lesions.5 For instance, the expression of VCAM-1, ICAM-1 or E-selectin has been observed not only in regions that are prone to atherosclerosis development but also in fatty streaks, and is likely, at least in part to be responsible for the recruitment of monocytes to these areas.28 Furthermore, a variety of atherogenic stimuli such as oxidized low-density lipoproteins and a number of proinflammatory cytokines have been shown to stimulate EC adhesion molecule expression.5 Hyperglycemia is also capable of inducing a hyper-adhesive endothelium3,15 that facilitates the interaction with leukocytes triggering inflammatory reactions within the vascular wall. Previously, we have demonstrated that SphK is an important regulator of the induction of adhesion molecules in EC.10,29 Having demonstrated the ability of hyperglycemia to cause SphK activation, a potential role of SphK in hyperglycemia-induced EC activation was suggested. Indeed, long-term exposure of EC to high glucose resulted in significant increases in VCAM-1, ICAM-1, and E-selectin expression, as reported previously.15 Increased expression of these proinflammatory adhesion molecules were completely reduced to basal levels by the coadministration of a specific SphK inhibitor, DMS, at a concentration of 2.5 eol/L. DMS has been reported to inhibit PKC activity when used at >20 eol/L.30 We sought to determine whether the observed inhibitory effect of DMS was attributable to a possible inhibition of PKC. As shown in Figure 3B, whereas DMS completely abolished the high glucoseeCinduced increase in SphK activity, the increased PKC activity was not affected when the cells were treated with DMS at 2.5 eol/L. This not only confirms the specificity of DMS as reported previously,19 but also indicates a specific role for SphK in mediating the adhesion molecule expression induced by high glucose.

    In a further characterization of the functional significance of hyperglycemia-induced increases in SphK activity, the interaction of EC with leukocytes was investigated in BAEC stably overexpressing SphKWT or a dominant-negative mutant, SphKG82D. Under NG conditions, adhesion of U937 cells to EC was markedly increased by overexpression of SphKWT (Figure 4C), supporting our previous findings that SphK is involved in the regulation of endothelial adhesion to leukocytes.10,29 In addition, consistent with our previous report,15 high-glucose treatment resulted in a significant increase in the adherence of leukocytes to EC. Remarkably, by blocking high glucoseeCinduced SphK activation without alterations in the baseline SphK activity, SphKG82D profoundly inhibited the adherence of leukocytes to the EC exposed to high glucose (Figure 4C). Moreover, the experiments with siRNA that specifically downregulated the expression of SphK1 and SphK2, the 2 isoforms of human SphK that account for total cellular SphK activity, demonstrated that endogenous SphK1, but not SphK2, is the key isoenzyme that is activated in response to high-glucose treatment (Figure 5). It is noteworthy that although SphK2 siRNA caused a decrease in the basal SphK activity, it had no effect on the high glucoseeCinduced increases in SphK activity. These results, together with the experiments using SphKG82D, strongly indicate that the activation of SphK1, but not basal SphK activity, is critical for the SphK-mediated proinflammatory phenotype of EC under ambient high-glucose conditions.

    The biological consequences of SphK activation rely on the actions of its product, S1P, which functions mainly through the receptors, including S1P1 to 4, and S1P5. These receptors are coupled with different G proteins: S1P1 and S1P4 couple mainly to Gi; both S1P2 and S1P3 activate Gi, Gq, and G12/13; and S1P5 is coupled to Gi/o and G12/13.21 As PTX is a specific inhibitor of Gi, the majority of S1P receptors are indeed sensitive to PTX.21 Interestingly, in the presence of PTX, high glucoseeCinduced adhesion molecule expression and the adhesion of leukocytes were attenuated by &30% (Figure 6) but to a much lesser degree than that observed following DMS administration (Figure 3). It is thus suggested that a Gi proteineCcoupled S1P receptoreCindependent action of S1P could contribute to the SphK-dependent EC activation. Exploring this idea further, we examined the bioactivity of S1P on EC, as characterized by changes in E-selectin expression. Effects of S1P on EC were also compared with other lysophospholipids that are structurally similar to S1P, such as LPA and dihydro-S1P. Interestingly, despite binding to different G proteineCcoupled receptors, LPA had an effect similar to that of S1P on the induction of E-selectin expression (Figure 6C). However, unlike S1P, LPA coadministration with PTX completely abrogated the LPA-induced E-selectin expression. This is in agreement with previous studies showing that the action of LPA on EC is solely dependent on its membrane receptors in a PTX-sensitive manner.11 In addition, treatment of EC with dihydro-S1P, a S1P analogue that can specifically bind to and activate S1P receptors,22 had no effect on E-selectin expression. Taken together, these results suggest that the intracellular mechanisms may account chiefly for the SphK-dependent proinflammatory signaling in EC exposed to high glucose, albeit the direct molecular targets of S1P remain to be identified. However, because of the heterogeneity and complexity of S1P receptors, a possible contribution of these receptors in the high glucoseeCinduced SphK-dependent EC activation requires further investigation.

    Further insight into the potential mechanism leading to SphK1 activation initially came from a study we reported recently,25 demonstrating that ERK1/2eCmediated phosphorylation is essential for SphK1 activation. Indeed, EC exposed to high glucose resulted in an increase in SphK1 phosphorylation. Treatment with PD98059 or U0126, acting specifically on ERK kinase 1 to block ERK1/2 activation, attenuated the high glucoseeCinduced increases in SphK1 phosphorylation and the enzyme activity, indicating a prominent role for ERK1/2. In addition, the observation that inhibition of PKC by GF109203X partially, but significantly, inhibited the high glucoseeCinduced SphK activity suggests the involvement of PKC in the activation of SphK1. This agrees with a previous report showing a potential role for PKC in activating SphK1.24 However, in light of our recent work, a direct role for PKC in SphK1 activation appears unlikely, with its reported minor effect on SphK1 activity in vitro.25 Additionally, inhibition of ERK1/2 was able to completely block phorbol 12-myristate 13-acetateeCinduced SphK activation, suggesting that the PKC-promoted SphK activation is dependent on ERK1/2 activation.25 Indeed, ERK1/2 activation has been suggested to be involved in the high glucoseeCactivated PKC-signaling pathway and to contribute to the hyperglycemic damage on vasculature.31

    NF-B is a master transcriptional factor that regulates a number of inflammation-related genes, including EC adhesion molecules.26 As already reported, vascular tissues from diabetic patients as well as cultured cells exposed to high glucose show increased binding activity of NF-B to promoter regions of many inflammatory genes.26,31 However, the precise molecular mechanism for glucose-induced NF-B activation remains unclear. We have previously demonstrated that SphK activation is required for NF-B activation induced by TNF- and that S1P is indeed a potent activator of NF-B.10,32 Herein, we provide evidence showing that high glucoseeCinduced NF-B activation was markedly inhibited by DMS administration or expression of SphKG82D in EC. Additionally, treatment of EC with S1P, mimicking the effect of high glucose, resulted in a significant increase in NF-BeCbinding activity. Whereas the high glucoseeCinduced NF-B activity was blocked by SphKG82D, S1P-induced NF-B activation was fully reserved in the SphKG82D-transfected cells (Figure 8). Thus, these findings not only reaffirm a role for SphK/S1P in the activation of NF-B, but also suggest that NF-B activation may serve as an important downstream signaling component of the SphK-mediated endothelial activation and the proinflammatory phenotype of EC under ambient high-glucose conditions.

    In conclusion, our findings demonstrate that hyperglycemia activates a new signal-transduction pathway triggered by SphK1 activation, leading to NF-B activation, adhesion molecule expression, and the endothelial proinflammatory phenotype, all of which are key events responsible for the development of vascular lesions associated with diabetes. Thus, this study provides a novel mechanistic explanation for the hyperglycemic damage on the vasculature and might ultimately allow the creation of a new strategy that limits the actions of this pathway for the prevention and treatment of diabetic vascular diseases.

    Acknowledgments

    This work was supported by a Career Development fellowship from the National Heart Foundation of Australia (to P.X.) and grants from the Juvenile Diabetes Research Foundation International and National Heart Foundation of Australia.

    References

    The Diabetes Control and Complications Trial Research Group. The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med. 1993; 329: 977eC986.

    UK Prospective Diabetes Study (UKPDS) Group. Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). Lancet. 1998; 352: 837eC853.

    Morigi M, Angioletti S, Imberti B, Donadelli R, Micheletti G, Figliuzzi M, Remuzzi A, Zoja C, Remuzzi G. Leukocyte-endothelial interaction is augmented by high glucose concentrations and hyperglycemia in a NF-kB-dependent fashion. J Clin Invest. 1998; 101: 1905eC1915.

    Kim JA, Berliner JA, Natarajan RD, Nadler JL. Evidence that glucose increases monocyte binding to human aortic endothelial cells. Diabetes. 1994; 43: 1103eC1107.

    Libby P. Inflammation in atherosclerosis. Nature. 2002; 420: 868eC874.

    Gonzalez MA, Selwyn AP. Endothelial function, inflammation, and prognosis in cardiovascular disease. Am J Med. 2003; 115 (suppl 8A): 99SeC106S.

    Guerci B, Kearney-Schwartz A, Bohme P, Zannad F, Drouin P. Endothelial dysfunction and type 2 diabetes. Part 1: physiology and methods for exploring the endothelial function. Diabetes Metab. 2001; 27: 425eC434.

    Lechleitner M, Koch T, Herold M, Dzien A, Hoppichler F. Tumour necrosis factor-alpha plasma level in patients with type 1 diabetes mellitus and its association with glycaemic control and cardiovascular risk factors. J Intern Med. 2000; 248: 67eC76.

    Katsuki A, Sumida Y, Murashima S, Murata K, Takarada Y, Ito K, Fujii M, Tsuchihashi K, Goto H, Nakatani K, Yano Y. Serum levels of tumor necrosis factor-alpha are increased in obese patients with noninsulin-dependent diabetes mellitus. J Clin Endocrinol Metab. 1998; 83: 859eC862.

    Xia P, Gamble JR, Rye KA, Wang L, Hii CS, Cockerill P, Khew-Goodall Y, Bert AG, Barter PJ, Vadas MA. Tumor necrosis factor-alpha induces adhesion molecule expression through the sphingosine kinase pathway. Proc Natl Acad Sci U S A. 1998; 95: 14196eC14201.

    Hla T, Lee MJ, Ancellin N, Paik JH, Kluk MJ. LysophospholipidseCreceptor revelations. Science. 2001; 294: 1875eC1878.

    Spiegel S, Milstien S. Sphingosine-1-phosphate: an enigmatic signalling lipid. Nat Rev Mol Cell Biol. 2003; 4: 397eC407.

    Saba JD, Hla T. Point-counterpoint of sphingosine 1-phosphate metabolism. Circ Res. 2004; 94: 724eC734.

    English D, Welch Z, Kovala AT, Harvey K, Volpert OV, Brindley DN, Garcia JG. Sphingosine 1-phosphate released from platelets during clotting accounts for the potent endothelial cell chemotactic activity of blood serum and provides a novel link between hemostasis and angiogenesis. FASEB J. 2000; 14: 2255eC2265.

    Verrier E, Wang L, Wadham C, Albanese N, Hahn C, Gamble JR, Chatterjee VK, Vadas MA, Xia P. PPARgamma agonists ameliorate endothelial cell activation via inhibition of diacylglycerol-protein kinase C signaling pathway: role of diacylglycerol kinase. Circ Res. 2004; 94: 1515eC1522.

    Pitson SM, Moretti PA, Zebol JR, Xia P, Gamble JR, Vadas MA, D’Andrea RJ, Wattenberg BW. Expression of a catalytically inactive sphingosine kinase mutant blocks agonist-induced sphingosine kinase activation. A dominant-negative sphingosine kinase. J Biol Chem. 2000; 275: 33945eC33950.

    Xia P, Wang L, Gamble JR, Vadas MA. Activation of sphingosine kinase by tumor necrosis factor-alpha inhibits apoptosis in human endothelial cells. J Biol Chem. 1999; 274: 34499eC34505.

    Xia P, Aiello LP, Ishii H, Jiang ZY, Park DJ, Robinson GS, Takagi H, Newsome WP, Jirousek MR, King GL. Characterization of vascular endothelial growth factor’s effect on the activation of protein kinase C, its isoforms, and endothelial cell growth. J Clin Invest. 1996; 98: 2018eC2026.

    Edsall LC, Van Brocklyn JR, Cuvillier O, Kleuser B, Spiegel S. N,N-Dimethylsphingosine is a potent competitive inhibitor of sphingosine kinase but not of protein kinase C: modulation of cellular levels of sphingosine 1-phosphate and ceramide. Biochemistry. 1998; 37: 12892eC12898.

    Pitson SM, D’Andrea RJ, Vandeleur L, Moretti PA, Xia P, Gamble JR, Vadas MA, Wattenberg BW Human sphingosine kinase: purification, molecular cloning and characterization of the native and recombinant enzymes. Biochem J. 2000; 350 (pt 2): 429eC441.

    Sanchez T, Hla T. Structural and functional characteristics of S1P receptors. J Cell Biochem. 2004; 92: 913eC922.

    Van Brocklyn JR, Lee MJ, Menzeleev R, Olivera A, Edsall L, Cuvillier O, Thomas DM, Coopman PJ, Thangada S, Liu CH, Hla T, Spiegel S. Dual actions of sphingosine-1-phosphate: extracellular through the Gi- coupled receptor Edg-1 and intracellular to regulate proliferation and survival. J Cell Biol. 1998; 142: 229eC240.

    Xia P, Inoguchi T, Kern TS, Engerman RL, Oates PJ, King GL. Characterization of the mechanism for the chronic activation of diacylglycerol-protein kinase C pathway in diabetes and hypergalactosemia. Diabetes. 1994; 43: 1122eC1129.

    Johnson KR, Becker KP, Facchinetti MM, Hannun YA, Obeid LM. PKC-dependent activation of sphingosine kinase 1 and translocation to the plasma membrane. Extracellular release of sphingosine-1-phosphate induced by phorbol 12-myristate 13-acetate (PMA). J Biol Chem. 2002; 277: 35257eC35262.

    Pitson SM, Moretti PA, Zebol JR, Lynn HE, Xia P, Vadas MA, Wattenberg BW. Activation of sphingosine kinase 1 by ERK1/2-mediated phosphorylation. EMBO J. 2003; 22: 5491eC5500.

    Read MA, Whitley MZ, Williams AJ, Collins T. NF-kappa B and I kappa B alpha: an inducible regulatory system in endothelial activation. J Exp Med. 1994; 179: 503eC512.

    Ross R. Atherosclerosis: an inflammatory disease. N Engl J Med. 1999; 340: 115eC126.

    O’Brien KD, McDonald TO, Chait A, Allen MD, Alpers CE. Neovascular expression of E-selectin, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1 in human atherosclerosis and their relation to intimal leukocyte content. Circulation. 1996; 93: 672eC682.

    Xia P, Vadas MA, Rye KA, Barter PJ, Gamble JR. High density lipoproteins (HDL) interrupt the sphingosine kinase signaling pathway. A possible mechanism for protection against atherosclerosis by HDL. J Biol Chem. 1999; 274: 33143eC33147.

    Hannun YA, Bell RM. Functions of sphingolipids and sphingolipid breakdown products in cellular regulation. Science. 1989; 243: 500eC507.

    Sheetz MJ, King GL. Molecular understanding of hyperglycemia’s adverse effects for diabetic complications. JAMA. 2002; 288: 2579eC2588.

    Xia P, Wang L, Moretti PA, Albanese N, Chai F, Pitson SM, D’Andrea RJ, Gamble JR, Vadas MA. Sphingosine kinase interacts with TRAF2 and dissects tumor necrosis factor-alpha signaling. J Biol Chem. 2002; 277: 7996eC8003.


  
《循环研究杂志》2005年10月第97卷第10期