the Department of Pharmacology, Asahikawa Medical College, Asahikawa (A.H., K.Y., T.F., T.Y., K.T., S.K., O.T., H.K., Y.O., C.-Y.X., H.M., F.U.)
the Department of Pharmacology, Kyoto University Faculty of Medicine, Kyoto (S.N.), Japan.
Abstract
Background— In the heart, the expressions of several types of prostanoid receptors have been reported. However, their roles in cardiac hypertrophy in vivo remain unknown. We intended to clarify the roles of these receptors in pressure overload–induced cardiac hypertrophy using mice lacking each of their receptors.
Methods and Results— We used a model of pressure overload–induced cardiac hypertrophy produced by banding of the transverse aorta in female mice. In wild-type mice subjected to the banding, cardiac hypertrophy developed during the observation period of 8 weeks. In mice lacking the prostaglandin (PG) I2 receptor (IP–/–), however, cardiac hypertrophy and cardiomyocyte hypertrophy were significantly greater than in wild-type mice at 2 and 4 weeks but not at 8 weeks, whereas there was no such augmentation in mice lacking the prostanoid receptors other than IP. In addition, cardiac fibrosis observed in wild-type hearts was augmented in IP–/– hearts, which persisted for up to 8 weeks. In IP–/– hearts, the expression level of mRNA for atrial natriuretic peptide, a representative marker of cardiac hypertrophy, was significantly higher than in wild-type hearts. In vitro, cicaprost, an IP agonist, reduced platelet-derived growth factor–induced proliferation of wild-type noncardiomyocytes, although it could not inhibit cardiotrophin-1–induced hypertrophy of cardiomyocytes. Accordingly, cicaprost increased cAMP concentration efficiently in noncardiomyocytes.
Conclusions— IP plays a suppressive role in the development of pressure overload–induced cardiac hypertrophy via the inhibition of both cardiomyocyte hypertrophy and cardiac fibrosis. Both effects have been suggested as originating from the action on noncardiomyocytes rather than cardiomyocytes.
Key Words: hypertrophy ; myocardium ; pressure ; prostaglandins ; thromboxanes
Introduction
Cardiac hypertrophy in response to pressure overload is a compensatory mechanism to maintain circulatory homeostasis.1 When the mechanical overload on the heart is severe and prolonged, however, it is an important risk factor in cardiac morbidity and mortality.2 In addition, many patients suffer from this condition because hypertension is a common cardiovascular disease that over time leads to cardiac hypertrophy. Therefore, the mechanisms underlying the development of pressure overload–induced cardiac hypertrophy have been studied extensively. Until now, several extracellular signaling molecules, such as endothelin, angiotensin II, and cardiotrophin-1, have been proposed as mediators promoting pressure overload–induced cardiac hypertrophy.3–5 In contrast, little is known about these signaling molecules that ameliorate pressure overload–induced cardiac hypertrophy.
Prostanoids, consisting of prostaglandins (PGs) and thromboxane, exert various actions in the cardiovascular system.6–8 PGI2 is known as a vasodilator and an inhibitor of platelet activation. In contrast, thromboxane A2 is a potent vasoconstrictor and a platelet stimulator. In the heart, several prostanoids, such as PGE2 and PGI2, have been reported to show cardioprotective actions against ischemia/reperfusion injury.9–11 In regard to cardiac hypertrophy, several reports suggest the participation of prostanoids in its development. These include inhibitory effects of PGI2 and its analogue on angiotensin II–induced hypertrophy in cultured cardiomyocytes12 and their inhibitory effects on proliferation and collagen synthesis in cultured cardiac fibroblasts.13 In addition, synthesis of PGE2 and PGI2 has been reported to be elevated in the hypertrophied and failing heart14,15 along with an upregulation of cyclooxygenase (COX)-2.16 The hypertrophic effect of exogenously administered PGF2 on cardiomyocytes has also been reported.17,18 Furthermore, several types and subtypes of prostanoid receptors have been reported to be expressed in the heart.6,7 These results suggest some roles played by these receptors in the development of pressure overload–induced cardiac hypertrophy; their exact roles in vivo, however, remain unknown.
DP, EP, FP, IP, and TP are the receptors for PGD2, PGE2, PGF2, PGI2, and thromboxane A2, respectively. In addition, there are 4 subtypes of EP: EP1, EP2, EP3, and EP4.6,7 In the present study we intended to clarify the roles of prostanoid receptors in pressure overload–induced cardiac hypertrophy using mice each lacking one of these receptors.
Methods
Mice
The generation and maintenance of mice lacking EP2, EP3, EP4, FP, IP, or TP (EP2–/–, EP3–/–, EP4–/–, FP–/–, IP–/–, and TP–/– mice, respectively) have been reported.19–24 All mice, including the wild-type control mice, but with the exception of EP4–/– mice, have a genetic background of C57BL/6 mice. EP4–/– mice have a mixed genetic background of 129sv/ola and C57BL/6 mice.21 For the experiments in which EP4–/– mice were used, F2 wild-type mice with a mixed genetic background similar to that of EP4–/– mice were used as a control. All experiments, which were approved by the Asahikawa Medical College Committee on Animal Research, were performed with the use of 12- to 15-week-old female mice or 18- to 20-day fetuses.
Expression of mRNAs for Prostanoid Receptors
To examine the expression of mRNAs for prostanoid receptors in the heart, we prepared total RNA from the heart using Isogen (Nippon Gene) and performed reverse transcription–polymerase chain reaction (RT-PCR) as reported.11,25 A similar procedure was used in the examination of IP mRNA expression in cardiomyocytes and noncardiomyocytes.
A Model of Pressure Overload–Induced Cardiac Hypertrophy
Pressure overload was produced by banding of the transverse aorta (transverse aortic constriction procedure) according to the reported method26 with minor modifications. Briefly, mice anesthetized with ketamine (100 mg/kg IP) and xylazine (5 mg/kg IP) were maintained under a respirator (model 480-7, Shinano Industry). After thoracotomy, the transverse aorta was exposed between the carotid arteries and was constricted by ligation with 7-0 nylon string along with a blunted 24-gauge needle, which needle was then pulled out. As controls, sham-operated mice were produced; they received essentially the same operation except for the aortic ligation. At indicated times after the banding, wet weight of the heart (HW) and body weight (BW) were measured, and their ratios (HW/BW ratio) were used as indices of cardiac hypertrophy.
To assess the degree of pressure overload, a polyethylene cannula, connected to a pressure transducer, was inserted into the right and left carotid arteries in some of the wild-type and IP–/– mice. Arterial pressure was measured before and at a steady state within 10 minutes after the banding.
Blood pressure and heart rate of conscious mice were measured by the tail-cuff method (BP-98A, Softron) between 9 AM and noon at indicated times after the banding, as reported.10 The values were obtained by averaging at least 5 measurements. The results showed that blood pressure and heart rate were not significantly different between wild-type and IP–/– mice at 1, 2, 4, or 8 weeks of the banding (data not shown). Similarly, blood pressure and heart rate at 4 weeks of the banding were not significantly different among wild-type, EP2–/–, EP3–/–, FP–/–, and TP–/– mice or between F2 wild-type and EP4–/– mice (Table 1).
Histological Analysis of the Heart
At indicated times, hearts were fixed with 10% formalin and embedded in paraffin. Five transverse sections (5-μm thickness) were prepared from the middle segment of the heart at intervals of 0.3 mm. The sections were stained with hematoxylin and eosin for examination of their gross appearance and were stained by the van Gieson method for measurements of cardiomyocyte hypertrophy and cardiac fibrosis. Cardiomyocyte hypertrophy was assessed by measuring cross-sectional area of 100 cardiomyocytes having nearly circular capillary profiles and nuclei in the left ventricle near the endocardial region. Cardiac fibrosis was assessed separately as interstitial and perivascular fibrosis by calculating the ratio of van Gieson–stained area of interstitial or perivascular fibrosis to total area of cardiac tissue in each section. These analyses were performed by digital planimetry with the use of NIH Image computer software.27
Expression of mRNAs for COXs and Atrial Natriuretic Peptide
We examined whether the cardiac expression of mRNAs for COX-1, a constitutive isoform, and COX-2, an inducible isoform, changes on pressure overload. We also examined cardiac expression of mRNA for atrial natriuretic peptide (ANP), a representative marker of cardiac hypertrophy. Total RNA was prepared from the left ventricles at indicated times,11 and the expression levels of the mRNAs were determined by RT-PCR with the use of the expression level of 18S ribosomal RNA (rRNA) as an internal control. The sequences of the primers used were as follows: COX-1 (sense), 5'CTGCTGAGAAGGGAGTTCATT3'; COX-1 (antisense), 5'GTCGCACACGCGGTTATGTT3'; COX-2 (sense), 5'ACACTCTATCACTGGCACCC3'; COX-2 (antisense), 5'GGACGAGGTTTTTCCA-CCAG3'; ANP (sense), 5'ATGGGCTCCTTCTCCATCACC3'; ANP (antisense), 5'TCCACTCTGGGCTCCAATCCTGT3'; 18S rRNA (sense), 5'ATCCTGCCAGTAGCATATGC3'; and 18S rRNA (antisense), 5'CCGAGGTTATCTAGAGTCAC3'.
Measurements of 6-Keto-PGF1 Contents in the Heart
To determine whether pressure overload increases PGI2 production in the heart, we measured the tissue contents of 6-keto-PGF1, a stable metabolite of PGI2. Tissue samples were prepared from the left ventricle of wild-type mice at indicated times after the aortic banding, and the contents of 6-keto-PGF1 were measured with an EIA kit (Cayman Chemical).
In Vitro Examination of Cardiomyocyte Hypertrophy and Noncardiomyocyte Proliferation
Cultures of cardiomyocytes and noncardiomyocytes were performed as reported.11 In short, cardiac ventricles of fetal mice were minced and then incubated with a buffer containing 0.1% collagenase (Wako) for 60 minutes at 37°C. The cells were filtrated through a nylon mesh, suspended in a culture medium (DMEM/F-12 supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin) containing 2.5% fetal calf serum, and then preplated onto a dish to separate cardiomyocytes from noncardiomyocytes. After incubation for 30 minutes, unattached cardiomyocytes were harvested and used for an assay. Attached noncardiomyocytes were grown to near confluence and then used for an assay.
Hypertrophy of cardiomyocytes was estimated by [14C]leucine incorporation, and proliferation of noncardiomyocytes was by [3H]thymidine incorporation and cell number. Cardiomyocytes were plated into 24-well culture plates at 105 cells per well. Noncardiomyocytes were plated into 24-well culture plates at 104 cells per well and into 6-well culture plates at 5x104 cells per well for examination of [3H]thymidine incorporation and cell number, respectively. After 48 hours of culture, culture medium was changed to a fresh one containing vehicle or cicaprost (10–5 mol/L, Schering), and indomethacin (10–5 mol/L, Sigma). In cardiomyocytes, cardiotrophin-1 (10–10 mol/L, Genzyme/Techne) and [14C]leucine (0.1 mCi/mL, Amersham) were added to the culture medium, and the cells were cultured for 48 hours. In noncardiomyocytes, platelet-derived growth factor (PDGF) (Peprotec) or fetal calf serum was added at 5 ng/mL or 0.5%, respectively, to the culture medium 30 minutes after the medium change. For examination of [3H]thymidine incorporation, the cells were cultured for 24 hours, and then [3H]thymidine (2 mCi/mL, Amersham) was added, and the cells were cultured for an additional 6 hours. For cell number count, the cells were cultured for 48 hours, harvested by trypsin-EDTA treatment, and counted with a hemocytometer. Amounts of [14C]leucine and [3H]thymidine incorporated into cardiomyocytes and noncardiomyocytes, respectively, were quantified by liquid scintillation counter.
Measurements of cAMP Accumulation
The cardiomyocytes and noncardiomyocytes were preincubated for 30 minutes at 37°C in the culture medium containing 10–5 mol/L indomethacin and 1 mmol/L 3-isobutyl-1-methylxanthine (Sigma-Aldrich). Then the cardiomyocytes were stimulated with vehicle, cicaprost (10–6 or 10–5 mol/L), or isoproterenol (10–7 mol/L, Nacalai Tesque), and the noncardiomyocytes were stimulated with vehicle or cicaprost (10–6 or 10–5 mol/L). After stimulation for 30 minutes at 37°C, the levels of intracellular cAMP ([cAMP]i) were measured as reported.25 We determined the protein contents of the cells by use of a BCA protein assay kit (Pierce Chemical).
Statistical Analysis
All values are expressed as mean±SEM. Statistical analysis was performed with 1-way (Figure 5 and Tables 1 and 2) or 2-way (Figures 1C, 2B, 3B, and 4 and Table 3) ANOVA followed by Duncan’s test for multiple comparisons. A difference was considered statistically significant at P<0.05 from the 2-tailed test. All data were analyzed with the software program Super ANOVA, version 1.11.
Results
Expression of mRNAs for Prostanoid Receptors in the Heart
We first examined which types and subtypes of prostanoid receptors are expressed in the heart using the RT-PCR method. We found the expression of mRNAs for EP2, EP3, EP4, FP, IP, and TP but not for EP1 and DP (Figure 1A).
In Vivo Model of Pressure Overload–Induced Cardiac Hypertrophy
On the basis of the results of RT-PCR analysis, we next examined cardiac hypertrophy using a model of pressure overload–induced cardiac hypertrophy in EP2–/–, EP3–/–, EP4–/–, FP–/–, IP–/–, and TP–/– mice. In wild-type mice, HW and HW/BW ratio at 4 weeks after aortic banding were significantly higher than that in sham-operated mice, indicating that the procedure induced cardiac hypertrophy. In IP–/– mice, however, HW and HW/BW ratio were significantly greater than those in wild-type mice, suggesting that IP mediated an antihypertrophic effect (Table 2 and Figures 1B and 1C). In contrast, there were no such differences among wild-type, EP2–/–, EP3–/–, FP–/–, and TP–/– mice or between F2 wild-type and EP4–/– mice (Table 2). In sham-operated groups, there was no significant difference in HW, BW, and HW/BW ratio among wild-type, EP2–/–, EP3–/–, FP–/–, and TP–/– mice or between F2 wild-type and EP4–/– mice (Table 2). These results suggest that IP is the only prostanoid receptor able to affect the development of pressure overload–induced cardiac hypertrophy, at least in the present model.
When the time course of the hypertrophy was examined, it was already apparent at 1 week after the banding, reached a maximum level at 2 weeks, and continued at a similar level thereafter (Figure 1C and Table 3). The HW or HW/BW ratio at 1 week was not significantly different between wild-type and IP–/– mice. At 2 and 4 weeks, however, both HW and HW/BW ratio in IP–/– mice were significantly greater than those in wild-type mice (Figure 1C and Table 3). At 8 weeks after the banding, however, there was no significant difference in the HW/BW ratio between wild-type and IP–/– mice, whereas HW was still significantly greater in IP–/– mice than in wild-type mice. There was no significant difference in BW after the banding between wild-type and IP–/– mice throughout the experiment (Table 3). These results clearly indicate that IP participates in the suppression of pressure overload–induced cardiac hypertrophy.
Before the banding, the systolic pressures in carotid arteries were 71.0±8.8 (n=4) and 70.0±6.4 (n=3) mm Hg in wild-type and IP–/– mice, respectively. After the banding, the systolic pressures in right carotid artery increased to 88.5±8.5 and 87.3±7.5 mm Hg, respectively, and those in left carotid artery decreased to 65.5±6.9 and 65.0±4.9 mm Hg, respectively, resulting in a pressure gradient of 23.0±1.6 and 22.3±2.7 mm Hg, respectively. This suggests that a similar degree of pressure overload was given between wild-type and IP–/– hearts by the procedure.
Cardiomyocyte Hypertrophy and Cardiac Fibrosis
Cardiac hypertrophy is associated frequently with both cardiomyocyte hypertrophy and cardiac fibrosis, with the latter consisting of both interstitial and perivascular fibrosis. To determine whether the antihypertrophic role of IP is due to inhibition of cardiomyocyte hypertrophy or cardiac fibrosis, we measured the cross-sectional area of cardiomyocytes (Figure 2) and the area of cardiac fibrosis (Figure 3). In wild-type mice, the cross-sectional area of cardiomyocytes and the area of cardiac fibrosis increased significantly after the banding compared with those in sham-operated mice, indicating the development of both cardiomyocyte hypertrophy and cardiac fibrosis.
At 1 week after the aortic banding, the cross-sectional area of cardiomyocytes was not significantly different between wild-type and IP–/– hearts (Figure 2B). At 2 and 4 weeks after the banding, however, it was significantly more augmented in IP–/– hearts than in wild-type hearts, indicating that IP-mediated signal suppressed the development of cardiomyocyte hypertrophy. At 8 weeks after the banding, the cross-sectional area of cardiomyocytes in IP–/– hearts was not significantly different from that in wild-type hearts, suggesting that mechanisms leading to cardiomyocyte hypertrophy caught up with the suppressive effect of IP.
In wild-type hearts, the increase in the area of perivascular fibrosis was already apparent at 1 week after the banding, and it further increased gradually thereafter (Figure 3B, top). In contrast, the increase in the area of interstitial fibrosis was not apparent at 1 week after the banding, reached a maximum level at 2 weeks, and then declined gradually (Figure 3B, bottom). The difference in the appearance times of perivascular and interstitial fibrosis may be derived from the different timing of inflammatory cell infiltration into these 2 areas,28 and the late-phase decline of interstitial fibrosis may suggest decreased contents of type III collagen during progression of cardiac fibrosis.29 At 1 week after the banding, both fibrotic areas were not significantly different between wild-type and IP–/– hearts (Figure 3B). At 2 and 4 weeks, however, these areas were significantly enlarged in IP–/– hearts compared with those in wild-type hearts. In contrast to cardiomyocyte hypertrophy, these fibrotic areas at 8 weeks were still significantly larger in IP–/– hearts than in wild-type hearts, suggesting a potent antifibrotic role of IP. These results indicate that IP participates in the suppression of both cardiomyocyte hypertrophy and cardiac fibrosis.
There was no significant difference in the cross-sectional area of cardiomyocytes and the area of interstitial and perivascular fibrosis among wild-type, EP2–/–, EP3–/–, FP–/–, and TP–/– mice or between F2 wild-type and EP4–/– mice at 4 weeks after the banding (see online-only Data Supplement).
Expression of ANP mRNA in the Heart
We next examined whether IP deficiency affects the cardiac expression of hypertrophy-related genes, in which we used ANP mRNA as a marker. In wild-type mice, the expression level of ANP mRNA increased significantly at 2 weeks of the banding compared with that in sham-operated mice (Figure 4), indicating that pressure overload induced gene expression along with the development of cardiac hypertrophy. In IP–/– hearts, however, expression levels were significantly higher than those in wild-type hearts throughout the experimental period. Moreover, in IP–/– hearts, its significant increase was apparent as early as 1 week after the banding. Interestingly, the expression level in sham-operated IP–/– mice was slightly but significantly higher than that in sham-operated wild-type mice, suggesting an inhibitory effect of basally produced PGI2 on ANP mRNA expression. These results suggest that stimulation of IP is able to modulate the expression of hypertrophy-related genes in the heart.
Expression of COX mRNAs and Production of PGI2 in the Heart
To determine whether pressure overload affects the expression of COXs and production of PGI2, we measured the expression levels of COX mRNAs and 6-keto-PGF1 contents in the left ventricle of wild-type mice. The expression level of mRNA for COX-1 or COX-2 did not change significantly after the banding throughout the experimental period compared with that before the banding (data not shown). In addition, the expression of COX-2 mRNA was barely detectable by the present method, and its level was significantly lower than that of COX-1 mRNA compared with the use of an 18S rRNA as an internal control. Accordingly, there was no significant change in the cardiac level of 6-keto-PGF1 throughout the experimental period; these values were 10.4±2.1 (n=4) and 9.3±2.3 (n=5) pg/mg wet weight in aortic-banded and sham-operated groups, respectively, at 1 week of the banding. These results indicate that the pressure overload did not affect COX mRNA expression or PGI2 production in the heart, whereas significant amounts of PGI2 were being produced in the heart irrespective of the presence or absence of pressure overload.
Effects of Cicaprost on Noncardiomyocyte Proliferation and Cardiomyocyte Hypertrophy
To determine whether the antihypertrophic effect of IP is derived from its action on noncardiomyocytes or cardiomyocytes, we examined the effects of cicaprost, an IP agonist, on noncardiomyocyte proliferation and cardiomyocyte hypertrophy. In wild-type noncardiomyocytes, PDGF increased [3H]thymidine incorporation 113% above control, indicating that PDGF could stimulate DNA synthesis of noncardiomyocytes (Figure 5A). Cicaprost significantly inhibited the PDGF-induced increase in [3H]thymidine incorporation in wild-type noncardiomyocytes, an effect that disappeared in IP–/– noncardiomyocytes, indicating that the effect was mediated by IP. Interestingly, the slight inhibitory effect of cicaprost on [3H]thymidine incorporation was also observed in PDGF-unstimulated wild-type noncardiomyocytes. Accordingly, cicaprost significantly inhibited PDGF-induced increase in cell number only in wild-type noncardiomyocytes (Figure 5B). These results indicate that stimulation of IP could inhibit proliferation of noncardiomyocytes induced by PDGF. In contrast, cicaprost failed to inhibit serum-induced proliferation of wild-type noncardiomyocytes (data not shown), suggesting a difference in signaling mechanisms between PDGF and serum. In wild-type cardiomyocytes, cardiotrophin-1 increased [14C]leucine incorporation 43% above control, indicating that cardiotrophin-1 could induce cardiomyocyte hypertrophy (Figure 5C). However, cicaprost could not modulate the cardiotrophin-1–induced increase in [14C]leucine incorporation, presenting the possibility that IP signaling is defective in cardiomyocytes.
To further evaluate the IP signaling in cardiomyocytes and noncardiomyocytes, we examined IP expression and its second messenger system in these cell types. When IP mRNA expression was examined by the RT-PCR method, we found that both cell types from wild-type mice expressed IP mRNA but those from IP–/– mice did not, and we found that its expression level was apparently much higher in noncardiomyocytes than in cardiomyocytes when GAPDH mRNA expression was used as a reference (Figure 5D). We next examined functionally whether stimulation of IP could activate the second messenger system in these cell types by measuring [cAMP]i because IP belongs to a Gs-coupled receptor family. In noncardiomyocytes, cicaprost increased [cAMP]i prominently: the increase was 260% above control at a concentration of 10–5 mol/L (Figure 5E). In contrast, the increase in cardiomyocytes was only 40%, whereas the ;-adrenergic agonist isoproterenol could increase it extensively in this cell type. These results indicate that IP-mediated signaling works more efficiently in noncardiomyocytes than in cardiomyocytes.
Discussion
In the present study pressure overload produced by the aortic banding caused marked cardiac hypertrophy, consisting of cardiomyocyte hypertrophy and cardiac fibrosis. The degree of cardiac hypertrophy after the banding was significantly greater in IP–/– mice than in wild-type mice and was accompanied by augmentation of both cardiomyocyte hypertrophy and cardiac fibrosis. In addition, the increase in the expression level of ANP mRNA after the banding was significantly augmented in IP–/– hearts compared with in wild-type hearts. These findings provide direct evidence that IP-mediated signaling plays a suppressive role in the development of pressure overload–induced cardiac hypertrophy and fibrosis.
Synthesis of PGI2 has been reported to be elevated in the hypertrophied and failing heart15 along with an upregulation of COX-2.16 In the present study, however, we found no significant increase in COX mRNA expression and PGI2 production after the aortic banding. This discrepancy may be derived from the differences in experimental conditions used or diseases studied. Accordingly, COX-2 upregulation in the heart has been reported in patients having congestive heart failure,16 and increased cardiac PGI2 production was transient in dogs subjected to aortic banding.15 Recently, involvement of proinflammatory cytokines in the pathogenesis of heart failure due to a variety of causes has been suggested.30 Our procedure of aortic banding was relatively mild in degree and did not induce apparent cardiac failure, suggesting little participation of inflammatory cytokines, a common inducer of COX-2, in the pathogenesis of the present cardiac hypertrophy. Nevertheless, cardiac 6-keto-PGF1 concentrations before and after the aortic banding were grossly estimated to be 30 to 50 nmol/L, a well-working range of PGI2. These results suggest that basally produced PGI2 could exhibit an antihypertrophic effect on the heart on a pressure overload and that increased production of PGI2 via COX-2 induction in failing hearts would further contribute to the suppression of cardiac hypertrophy.
Because pressure overload–induced cardiac hypertrophy was accompanied by both cardiomyocyte hypertrophy and cardiac fibrosis, we next investigated whether the antihypertrophic role of IP depends on its effect on cardiomyocytes or noncardiomyocytes. In wild-type noncardiomyocytes, cicaprost significantly suppressed PDGF-induced proliferation; this growth factor was reportedly implicated in the development of cardiac hypertrophy and fibrosis.31 This result is in good agreement with a report that PGI2 was a major prostanoid produced by cultured cardiac fibroblasts and that an IP agonist inhibited fibroblast proliferation and expression of collagen type I and III mRNAs.13 In addition, antifibrotic effects of PGI2 have also been reported in extracardiac tissues, such as blood vessels and the kidney.32,33 These results indicate that stimulation of IP reduces the proliferation of noncardiomyocytes and suggest that stimulation of IP on fibroblasts accounts for its suppressive effect on pressure overload–induced cardiac fibrosis.
In wild-type cardiomyocytes, cicaprost failed to reduce the cardiotrophin-1–induced hypertrophy, agreeing with a previous report that PGI2 did not show a direct antihypertrophic action on cultured rat cardiomyocytes.12,17 It is noteworthy that angiotensin II–induced cardiomyocyte hypertrophy was totally dependent on several factors secreted from noncardiomyocytes, such as endothelin and cardiotrophin-1.34,35 Accordingly, the action of IP on noncardiomyocytes may be involved in the underlying mechanism of its suppressive effects on cardiomyocyte hypertrophy in vivo. In support of this idea, PGI2 was reported to be capable of attenuating hypertrophy of cardiomyocytes when they were cocultured with noncardiomyocytes, although it did not have a direct antihypertrophic effect on cardiomyocytes.12 These results suggest that PGI2 acts on noncardiomyocytes and inhibits their release of hypertrophy-inducible factors, leading to the suppression of cardiomyocyte hypertrophy.
In the present study the expression of IP mRNA and the IP-mediated increase in [cAMP]i were apparently much greater in noncardiomyocytes than in cardiomyocytes, suggesting further that activation of IP on noncardiomyocytes would be more important in the suppression of cardiac hypertrophy. However, we could not exclude a role of IP on cardiomyocytes in the suppression of cardiac hypertrophy because IP mRNA was expressed in cardiomyocytes and because its stimulation induced a small but significant increase in [cAMP]i. Further studies would be required to clarify the detailed mechanisms of antihypertrophic role of IP in pressure overload–induced cardiac hypertrophy.
We found the expression of mRNAs for EP2, EP3, EP4, FP, and TP in addition to that for IP in the heart. In a model of pressure overload–induced cardiac hypertrophy in vivo, however, the degree of cardiac hypertrophy in EP2–/–, EP3–/–, EP4–/–, FP–/–, or TP–/– mice was not significantly different compared with that in their respective wild-type mice. This result suggests that neither EP subtype, FP, or TP plays a major role in the present model of pressure overload–induced cardiac hypertrophy. In contrast, there are several reports suggesting hypertrophic effects of exogenously administered PGF2 on rat cardiomyocyte both in vivo and in vitro,17,18 although there has been no report showing the hypertrophic effect of endogenous PGF2. The apparent discrepancy in the effect of PGF2 may be derived from a species difference, as reported; the hypertrophic effect of PGF2 on cultured cardiomyocytes found in rats was not observed in mice.36 Alternatively, amounts of endogenously produced PGF2 may be insufficient to affect pressure overload–induced cardiac hypertrophy in vivo.
PGI2 is a major prostanoid in the cardiovascular system and exerts a variety of actions in the system. It exhibits a cardioprotective effect in ischemia/reperfusion injury10 and plays a part in the late phase of ischemic preconditioning.9 A recent study has shown that neointimal formation in the carotid artery after endothelial injury is markedly enhanced in IP–/– mice, suggesting an antiproliferative effect of PGI2 on vascular smooth muscle cells.37 In agreement with this effect, PGI2 analogues have long been used for the treatment of primary pulmonary hypertension.38 Recently, a gene therapy using PGI2 synthase gene transfection has been tested in rat models of cardiovascular diseases, such as pulmonary hypertension,39 vascular remodeling,40 and peripheral vascular occlusion,41 and has been shown to be promising. Furthermore, the present study showed a novel role of IP in pressure overload–induced cardiac hypertrophy, emphasizing, along with previous reports, a potent therapeutic potential of PGI2 for cardiovascular diseases. It should be noted, however, that there may be a species difference in the effect of IP, as shown in the present study for the effect of FP on cardiomyocyte hypertrophy, indicating that the usefulness of PGI2 for the treatment of cardiac hypertrophy and heart failure remains to be determined in future studies.
In conclusion, the present study clearly showed that IP-mediated signaling suppresses the development of pressure overload–induced cardiac hypertrophy via its inhibition of both cardiomyocyte hypertrophy and cardiac fibrosis. The finding should contribute to better understanding of the mechanism underlying cardiac hypertrophy.
Acknowledgments
This work was supported by a grant-in-aid for scientific research from the Ministry of Education, Science, Sports, and Culture of Japan and by the research grant for cardiovascular disease (14A-1) from the Ministry of Health and Welfare of Japan. This work was also supported by grants from Ono Pharmaceutical Co, Smoking Research Foundation, Akiyama Foundation, and Hokkaido Heart Association.
Footnotes
The online-only Data Supplement can be found with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.104.527077/DC1.
References
Scheuer J, Buttrick P. The cardiac hypertrophic responses to pathologic and physiologic loads. Circulation. 1987; 75 (suppl I): 63–68.
Levy D, Garrison RJ, Savage DD, Kannel WB, Castelli WP. Prognostic implications of echocardiographically determined left ventricular mass in the Framingham Heart Study. N Engl J Med. 1990; 322: 1561–1566.
Ito H, Hiroe M, Hirata Y, Fujisaki H, Adachi S, Akimoto H, Ohta Y, Marumo F. Endothelin ETA receptor antagonist blocks cardiac hypertrophy provoked by hemodynamic overload. Circulation. 1994; 89: 2198–2203.
Senbonmatsu T, Ichihara S, Price E Jr, Gaffney FA, Inagami T. Evidence for angiotensin II type 2 receptor–mediated cardiac myocyte enlargement during in vivo pressure overload. J Clin Invest. 2000; 106: R25–R29.
Takimoto Y, Aoyama T, Iwanaga Y, Izumi T, Kihara Y, Pennica D, Sasayama S. Increased expression of cardiotrophin-1 during ventricular remodeling in hypertensive rats. Am J Physiol. 2002; 282: H896–H901.
Coleman RA, Smith WL, Narumiya S. International Union of Pharmacology classification of prostanoid receptors: properties, distribution, and structure of the receptors and their subtypes. Pharmacol Rev. 1994; 46: 205–229.
Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid receptors: structures, properties, and functions. Physiol Rev. 1999; 79: 1193–1226.
Ushikubi F, Hirata M, Naruniya S. Platelet prostaglandin receptors. In: von Bruchhausen F, Walter U, eds. Hand Book of Experimental Pharmacology, Volume 126: Platelets and Their Factors. Berlin, Germany: Springer-Verlag; 1997: 135–154.
Shinmura K, Tang XL, Wang Y, Xuan YT, Liu SQ, Takano H, Bhatnagar A, Bolli R. Cyclooxygenase-2 mediates the cardioprotective effects of the late phase of ischemic preconditioning in conscious rabbits. Proc Natl Acad Sci U S A. 2000; 97: 10197–10202.
Xiao CY, Hara A, Yuhki K, Fujino T, Ma H, Okada Y, Takahata O, Yamada T, Murata T, Narumiya S, Ushikubi F. Roles of prostaglandin I2 and thromboxane A2 in cardiac ischemia-reperfusion injury: a study using mice lacking their respective receptors. Circulation. 2001; 104: 2210–2215.
Xiao CY, Yuhki K, Hara A, Fujino T, Kuriyama S, Yamada T, Takayama K, Takahata O, Karibe H, Taniguchi T, Narumiya S, Ushikubi F. Prostaglandin E2 protects the heart from ischemia-reperfusion injury via its receptor subtype EP4. Circulation. 2004; 109: 2462–2468.
Ritchie RH, Schiebinger RJ, LaPointe MC, Marsh JD. Angiotensin II–induced hypertrophy of adult rat cardiomyocytes is blocked by nitric oxide. Am J Physiol. 1998; 275: H1370–H1374.
Yu H, Gallagher AM, Garfin PM, Printz MP. Prostacyclin release by rat cardiac fibroblasts: inhibition of collagen expression. Hypertension. 1997; 30: 1047–1053.
Zamorano B, Carmona MT. Prostaglandin-E2 and cyclic adenosine 3'-5' monophosphate levels in hypertrophied rat heart. Biol Res. 1992; 25: 85–89.
Newman WH, Frankis MB, Halushka PV. Increased myocardial release of prostacyclin in dogs with heart failure. J Cardiovasc Pharmacol. 1983; 5: 194–201.
Wong SC, Fukuchi M, Melnyk P, Rodger I, Giaid A. Induction of cyclooxygenase-2 and activation of nuclear factor-B in myocardium of patients with congestive heart failure. Circulation. 1998; 98: 100–103.
Adams JW, Migita DS, Yu MK, Young R, Hellickson MS, Castro-Vargas FE, Domingo JD, Lee PH, Bui JS, Henderson SA. Prostaglandin F2 stimulates hypertrophic growth of cultured neonatal rat ventricular myocytes. J Biol Chem. 1996; 271: 1179–1186.
Lai J, Jin H, Yang R, Winer J, Li W, Yen R, King KL, Zeigler F, Ko A, Cheng J, Bunting S, Paoni NF. Prostaglandin F2 induces cardiac myocyte hypertrophy in vitro and cardiac growth in vivo. Am J Physiol. 1996; 271: H2197–H2208.
Hizaki H, Segi E, Sugimoto Y, Hirose M, Saji T, Ushikubi F, Matsuoka T, Noda Y, Tanaka T, Yoshida N, Narumiya S, Ichikawa A. Abortive expansion of the cumulus and impaired fertility in mice lacking the prostaglandin E receptor subtype EP2. Proc Natl Acad Sci U S A. 1999; 96: 10501–10506.
Ushikubi F, Segi E, Sugimoto Y, Murata T, Matsuoka T, Kobayashi T, Hizaki H, Tuboi K, Katsuyama M, Ichikawa A, Tanaka T, Yoshida N, Narumiya S. Impaired febrile response in mice lacking the prostaglandin E receptor subtype EP3. Nature. 1998; 395: 281–284.
Segi E, Sugimoto Y, Yamasaki A, Aze Y, Oida H, Nishimura T, Murata T, Matsuoka T, Ushikubi F, Hirose M, Tanaka T, Yoshida N, Narumiya S, Ichikawa A. Patent ductus arteriosus and neonatal death in prostaglandin receptor EP4-deficient mice. Biochem Biophys Res Commun. 1998; 246: 7–12.
Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y, Nishimura T, Oida H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K, Murata T, Hirata M, Ushikubi F, Negishi M, Ichikawa A, Narumiya S. Failure of parturition in mice lacking the prostaglandin F receptor. Science. 1997; 277: 681–683.
Murata T, Ushikubi F, Matsuoka T, Hirata M, Yamasaki A, Sugimoto Y, Ichikawa A, Aze Y, Tanaka T, Yoshida N, Ueno A, Oh-ishi S, Narumiya S. Altered pain perception and inflammatory response in mice lacking prostacyclin receptor. Nature. 1997; 388: 678–682.
Kabashima K, Murata T, Tanaka H, Matsuoka T, Sakata D, Yoshida N, Katagiri K, Kinashi T, Tanaka T, Miyasaka M, Nagai H, Ushikubi F, Narumiya S. Thromboxane A2 modulates interaction of dendritic cells and T cells and regulates acquired immunity. Nat Immunol. 2003; 4: 694–670.
Ma H, Hara A, Xiao CY, Okada Y, Takahata O, Nakaya K, Sugimoto Y, Ichikawa A, Narumiya S, Ushikubi F. Increased bleeding tendency and decreased susceptibility to thromboembolism in mice lacking the prostaglandin E receptor subtype EP3. Circulation. 2001; 104: 1176–1180.
Rockman HA, Ross RS, Harris AN, Knowlton KU, Steinhelper ME, Field LJ, Ross J Jr, Chien KR. Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci U S A. 1991; 88: 8277–8281.
Akishita M, Iwai M, Wu L, Zhang L, Ouchi Y, Dzau VJ, Horiuchi M. Inhibitory effect of angiotensin II type 2 receptor on coronary arterial remodeling after aortic banding in mice. Circulation. 2000; 102: 1684–1689.
Nicoletti A, Michel JB. Cardiac fibrosis and inflammation: interaction with hemodynamic and hormonal factors. Cardiovasc Res. 1999; 41: 532–543.
Weber KT, Janicki JS, Shroff SG, Pick R, Chen RM, Bashey RI. Collagen remodeling of the pressure-overloaded, hypertrophied nonhuman primate myocardium. Circ Res. 1988; 62: 757–765.
Murray DR, Freeman GL. Proinflammatory cytokines: predictors of a failing heart; Circulation. 2003; 107: 1460–1462.
Suzuki J, Baba S, Ohno I, Endoh M, Nawata J, Miura S, Yamamoto Y, Sekiguchi Y, Takita T, Ogata M, Tamaki K, Ikeda J, Shirato K. Immunohistochemical analysis of platelet-derived growth factor-B expression in myocardial tissues in hypertrophic cardiomyopathy. Cardiovasc Pathol. 1999; 8: 223–231.
Kouchi Y, Esato K, O-Hara M, Zempo N. Effect of prostaglandin I2 analogue TRK-100 on the suppression of intimal fibrous proliferation. J Vasc Surg. 1992; 16: 232–238.
Yokoyama C, Yabuki T, Shimonishi M, Wada M, Hatae T, Ohkawara S, Takeda J, Kinoshita T, Okabe M, Tanabe T. Prostacyclin-deficient mice develop ischemic renal disorders, including nephrosclerosis and renal infarction. Circulation. 2002; 106: 2397–2403.
Harada M, Itoh H, Nakagawa O, Ogawa Y, Miyamoto Y, Kuwahara K, Ogawa E, Igaki T, Yamashita J, Masuda I, Yoshimasa T, Tanaka I, Saito Y, Nakao K. Significance of ventricular myocytes and nonmyocytes interaction during cardiocyte hypertrophy: evidence for endothelin-1 as a paracrine hypertrophic factor from cardiac nonmyocytes. Circulation. 1997; 96: 3737–3744.
Kuwahara K, Saito Y, Harada M, Ishikawa M, Ogawa E, Miyamoto Y, Hamanaka I, Kamitani S, Kajiyama N, Takahashi N, Nakagawa O, Masuda I, Nakao K. Involvement of cardiotrophin-1 in cardiac myocyte-nonmyocyte interactions during hypertrophy of rat cardiac myocytes in vitro. Circulation. 1999; 100: 1116–1124.
Deng XF, Rokosh DG, Simpson PC. Autonomous and growth factor–induced hypertrophy in cultured neonatal mouse cardiac myocytes: comparison with rat. Circ Res. 2000; 87: 781–788.
Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T, Lawson JA, FitzGerald GA. Role of prostacyclin in the cardiovascular response to thromboxane A2. Science. 2002; 296: 539–541.
Archer S, Rich S. Primary pulmonary hypertension: a vascular biology and translational research "work in progress." Circulation. 2000; 102: 2781–2791.
Nagaya N, Yokoyama C, Kyotani S, Shimonishi M, Morishita R, Uematsu M, Nishikimi T, Nakanishi N, Ogihara T, Yamagishi M, Miyatake K, Kaneda Y, Tanabe T. Gene transfer of human prostacyclin synthase ameliorates monocrotaline-induced pulmonary hypertension in rats. Circulation. 2000; 102: 2005–2010.
Todaka T, Yokoyama C, Yanamoto H, Hashimoto N, Nagata I, Tsukahara T, Hara S, Hatae T, Morishita R, Aoki M, Ogihara T, Kaneda Y, Tanabe T. Gene transfer of human prostacyclin synthase prevents neointimal formation after carotid balloon injury in rats. Stroke. 1999; 30: 419–426.
Hiraoka K, Koike H, Yamamoto S, Tomita N, Yokoyama C, Tanabe T, Aikou T, Ogihara T, Kaneda Y, Morishita R. Enhanced therapeutic angiogenesis by cotransfection of prostacyclin synthase gene or optimization of intramuscular injection of naked plasmid DNA. Circulation. 2003; 108: 2689–2696.
Inhibition of Histone Deacetylation Blocks Cardiac Hypertrophy Induced by Angiotensin II Infusion and Aortic Banding
Cardiac-Specific Overexpression of Diacylglycerol Kinase Prevents Gq Protein-Coupled Receptor Agonist-Induced Cardiac Hypertrophy in Transgenic Mice
Decreased Perivascular Fibrosis but Not Cardiac Hypertrophy in ROCK1+/– Haploinsufficient Mice
Supranormal Myocardial Creatine and Phosphocreatine Concentrations Lead to Cardiac Hypertrophy and Heart Failure
Electrophysiological Characteristics of Septal Hypertrophy in Patients With Hypertrophic Obstructive Cardiomyopathy and Moderate to Severe Symptoms
Nox1 Overexpression Potentiates Angiotensin II-Induced Hypertension and Vascular Smooth Muscle Hypertrophy in Transgenic Mice
Requirement of Nuclear Factor-B in Angiotensin II– and Isoproterenol-Induced Cardiac Hypertrophy In Vivo
AFos Dissociates Cardiac Myocyte Hypertrophy and Expression of the Pathological Gene Program
-Adrenergic Receptor–Stimulated Hypertrophy in Adult Rat Ventricular Myocytes Is Mediated via Thioredoxin-1–Sensitive Oxidative Modification of Thiols on Ras
Adenovirus-Mediated Overexpression of Diacylglycerol Kinase- Inhibits Endothelin-1–Induced Cardiomyocyte Hypertrophy