the Human Neurotransmitter Laboratory, Baker Heart Research Institute, Melbourne, Victoria, Australia (K.M.)
Department of Geriatric Medicine, Osaka University Graduate School of Medicine, Suita City, Osaka, Japan (K.M., T.K., Y.F., H.R., T.O.)
Metabolism and Endocrinology Division, Sepulveda VA Medical Center, and David Geffen UCLA School of Medicine, Los Angeles, Calif (M.L.T.).
Abstract
Background— The genes responsible for obesity are candidate genes for obesity-related diseases, such as hypertension. Functional polymorphisms in the ;2- and ;3-adrenergic receptors have been reported to be associated with hypertension and obesity.
Methods and Results— To longitudinally clarify the relevance to alterations in ;-adrenergic receptor polymorphisms related to weight gain, blood pressure (BP) elevation, and sympathetic nerve activity as measured by plasma norepinephrine level, we studied 160 young, nonobese, normotensive men. Changes in body weight, BP, plasma norepinephrine levels, and ;2-adrenergic (Arg16Gly, Gln27Glu) and ;3-adrenergic (Trp64Arg) receptor polymorphisms were measured periodically over a 5-year period. Weight gain and BP elevation were defined as 10% increases from entry levels over 5 years in body mass index or mean BP. The presence of the Gly16 allele of Arg16Gly was associated with a higher frequency of weight gain and BP elevation over the 5-year period. The subjects carrying the Glu27 allele of Gln27Glu and the Trp64 allele of Trp64Arg had a higher frequency of BP elevation. Significantly higher levels of plasma norepinephrine at entry and at year 5 were observed in the subjects with the Gly16 allele of Arg16Gly and the Glu27 allele of Gln27Glu compared with those without the Gly16 or the Glu27 alleles.
Conclusions— These results demonstrate that the Gly16 allele is related to greater weight gain and BP elevation. Additionally, Glu27 and Trp64 alleles are linked to BP elevation. The subjects carrying the ;2-polymorphisms linked to weight gain and BP elevation also have higher plasma norepinephrine levels that are present at entry before weight gain and BP elevation. These findings suggest that ;2-adrenergic receptor polymorphisms in association with a heightened sympathetic nerve activity could predict the future onset of obesity and hypertension, as shown in the 5-year longitudinal study.
Key Words: hypertension ; norepinephrine ; obesity
Introduction
Obesity and obesity-related cardiovascular disease are a rapidly growing public health problem,1 and there is evidence that human obesity and hypertension have strong genetic as well as environmental determinants.2–4 Reduced energy expenditure and resting metabolic rate are predictive of weight gain, and the sympathetic nervous system participates in regulating energy balance through thermogenesis. The thermogenic effects in obesity have been mainly attributed to the activity of the ;1- and ;2-adrenergic receptors in humans. However, reports of an association of ;2-adrenergic receptor polymorphisms with hypertension and obesity have been discordant.5–7 Several observations have shown that the Trp64Arg polymorphism of the ;3-adrenergic receptor gene can also be associated with obesity8–10; however, this finding has not been confirmed in other studies.11,12 Few studies have simultaneously taken into account obesity and hypertension as related to polymorphisms of ;-adrenoceptor genes in the same study population followed longitudinally for several years. Additionally, plasma norepinephrine levels, as an index of sympathetic nerve activity (SNA), are also included in the present study.
Thus, this study examines the associations of polymorphisms of ;-adrenergic receptors with plasma norepinephrine level (index of SNA), weight gain (obesity), and blood pressure (BP) elevation (hypertension) over 5 years in 160 subjects who at entry were young, nonobese, and normotensive.
Methods
Subjects
Subjects were recruited from a cohort of 1121 men who work in a single company in Osaka, Japan, as part of their annual medical evaluation. Subjects at study entry were excluded who were aged >50 years, had obesity (body mass index [BMI] 25 kg/m2),13,14 had diabetes mellitus (fasting glucose level >100 mg/dL), and had hypertension (140/90 mm Hg). We also excluded subjects who were taking medication for hypertension, hyperlipidemia, hyperuricemia, or other illness. Only subjects who had steady body weight (weight had not changed significantly [<5%] over the past year before the entry period) were enrolled in this study.15,16 After exclusion, 160 young, nonobese (BMI <25 kg/m2), normotensive (<140/90 mm Hg) men on no medications were enrolled in the present study. Informed consent was obtained from each subject, as approved by the Ethics Committee of Osaka University Graduate School of Medicine, Osaka, Japan.
Measurements
After an overnight fast of >12 hours, BMI, total body fat mass, ratio of waist circumference to hip circumference (waist-to-hip ratio), BP, heart rate, venous sampling for plasma norepinephrine, and extraction of genomic DNA from leukocytes were taken every year for 5 years. BP and heart rate were measured with the subject in the recumbent position with an automated sphygmomanometer (TM-2713, A&D) with an adjusted cuff size, which had been standardized against a mercury sphygmomanometer. The percent body fat mass was determined with impedance measurements (BF-102, Tanita), and total body fat mass (kg) was calculated according to the following formula: (percent body fat mass/100)xbody weight (kg).
Laboratory Determinations
Plasma norepinephrine was measured by high-performance liquid chromatography with a fluorometric method as previously described for this laboratory17 (intra-assay coefficient of variation=2.1%; interassay coefficient of variation=3.6%; sensitivity=0.06 to 120 nmol/L).
Genotyping
Genotyping was performed by the TaqMan assay as previously described.18 Two polymorphisms in the ;2-adrenergic receptors (arginine/glycine substitution, Arg16Gly; glutamine/glutamate substitution, Gln27Glu) of the ;2-adrenoceptor gene were studied.6 One polymorphism (tryptophan/arginine substitution, Trp64Arg) of the ;3-adrenoceptor gene was also studied.19,20 The probes and primers used in the TaqMan assay were as follows. For single-nucleotide polymorphisms in the ;2-adrenergic receptor gene, the probes and primers were as follows: for Arg16Gly, the probes were CGCATGGCTTCCATTGGGTGC and CGCATGGCTTCTATTGGGTGC, and the primers were GGAACGGCAGCGCCTTCT and CAGGACGATGAGAGACATGACGAT; for Gln27Glu, the probes were CTCGTCCCTTTCCTGCGTGACGT and CTCGTCCCTTTGCTGCGTGACGT (the primers used in this assay were the same as those used for Arg16Gly). For the Trp64Arg single-nucleotide polymorphism in the ;3-adrenergic receptors, the probes were TCTCGGAGTCCAGGCGATGGCCA and CTCGGAGTCCGGGCGATGGCC, and the primers were GGAGGCAACCTGCTGGTCAT and CACGAACACGTTGGTCATGGT.
Statistical Analysis
Genotype frequencies and the Hardy-Weinberg equilibrium were estimated with 2 test. Values are shown as mean±SD. All data analyses were performed with SPSS 8.0 for Windows programs. Changes in measured parameters within each group and differences among groups were examined by 2-way ANOVA. When these differences were significant, the Dunnett test was used to determine whether the differences of the mean measured variables at entry and 5 years were significant within the groups and among the groups compared from baseline. Values of P<0.05 were considered significant.
Results
Significant weight gain and BP elevation over 5 years were defined as a 10% increase in BMI or mean BP compared with values at entry.16,21 Fifty-nine subjects had significant weight gain over 5 years, and 41 subjects had significant BP elevation. Table 1 shows the prevalence of weight gain and BP elevation at year 5. No subjects with the Glu27/Glu27 polymorphism of the ;2-adrenoceptor were detected in the present study. The allele frequency of Glu27 of the ;2-adrenoceptor polymorphism was 4.6%, and that of Arg64 of the ;3-adrenoceptor polymorphism was 17.4%, but all studied loci allele and genotype frequencies were in accordance with the Hardy-Weinberg equilibrium. The frequency distributions for homozygosity for the Arg16 and Gly16 alleles in this study were 28.1% and 22.5%. The frequency distributions for homozygosity for the Gln27 and Glu27 were 90.7% and 0.0%, and the frequency distributions for the Trp64 and Arg64 were 67.1% and 1.9%. The frequency distributions for homozygosity for the Glu27 and the Arg64 in our subjects were similar to those in previous studies in Japanese cohorts but lower than those found in studies in white subjects.5,6,9,10,22,23 The frequency of Gly16 allele of the ;2-adrenoceptor gene was greater in subjects with weight gain than in those without weight gain. Additionally, the frequency of the Gly16 allele of the ;2-adrenergic receptor gene was significantly greater in subjects who showed a significant BP elevation over 5 years. The frequencies of the Glu27 and Trp64 alleles were higher in subjects with BP elevation than in those without BP elevation (Table 1).
Furthermore, to evaluate the relationships between the ;-adrenoceptor alleles and weight gain-related BP elevation, we compared the frequencies of alleles between the groups with and without BP elevation in subjects who significantly gained body weight versus those without weight gain. In subjects who had a significant weight gain, those who also had a significant BP elevation carried a higher frequency of the Gly16 and Glu27 alleles compared with those without a significant BP elevation (2=4.73, P=0.030; 2=6.35, P=0.012, respectively). In subjects who did not gain weight over the 5-year period, the allele frequencies in the 3 genotypes that were studied were similar in subjects with and without a BP elevation over time.
Subjects were divided into the 2 subgroups in each studied genotype according to the dominant allele. Characteristics between those with and without the dominant allele are shown in Tables 3, 4, and 5 . Total body fat mass and waist-to-hip ratio at entry in the subjects carrying the Gly16 allele and Glu allele of the ;2-adrenoceptor gene were greater than in the other genotypes (Tables 3 and 4). BMI and total body fat mass increased significantly in the subjects with the Gly16 allele and Glu27 allele of the ;2-adrenoceptor genes. Subjects who had the Gly16 and Glu27 of the ;2-adrenoceptor gene and the Trp64 of the ;3-adrenoceptor gene had significant increments in mean BP over the 5 years (Tables 3, 4, and 5 HREF="#TBL4">).
As we have previously reported,15,16,21 subjects with the most significant weight gain and BP elevation had the highest levels of plasma norepinephrine at entry compared with subjects without weight gain or BP elevation (Table 2). Plasma norepinephrine levels at both entry and year 5 were greater in subjects carrying Gly16 allele and Glu27 allele of the ;2-adrenoceptor genes than in the other genotypes (Tables 3 and 4). Plasma norepinephrine levels increased significantly over the 5-year period in those subjects with the abnormal ;-adrenoceptor alleles. The same subjects also had higher plasma norepinephrine levels at entry.
Discussion
The present study shows that the Arg16Gly and the Gln27Glu of the ;2-adrenoceptor and the Trp64Arg of the ;3-adrenoceptor polymorphisms have a substantial influence on future gain in body weight or BP elevation in male subjects who were originally nonobese and normotensive. The subjects carrying the polymorphism for the Gly16, Glu27, and Trp64 alleles show higher frequency in those who had a significant weight gain or BP elevation over the 5-year study. Higher levels of plasma norepinephrine at entry were also seen in the groups with the Gly16 or Glu27 alleles. As we have shown in all studies, a heightened SNA (high mean plasma norepinephrine) predicted subsequent weight gain and BP elevation.15,16,21 Now we show that the increased SNA is in part determined by the genetic influence of the ;2-adrenergic receptor systems.
Pathophysiological involvement of genetic abnormalities in the ;2-adrenergic receptor system in hypertension and obesity are well described.5,6,24–26 Among ;2-adrenergic receptor polymorphisms, Arg16Gly and Gln27Glu are considered the most functionally important.5,6,24–26 Gratze et al27 found that young normotensive white men homozygous for the Gly16 allele of the ;2-adrenoceptor gene had higher BP and lower peripheral vasodilation after infusion of the ;-blocker salbutamol. The Gly16 substitution exaggerates agonist-mediated receptor downregulation.6,28 Our findings that the Gly16 allele is associated with weight gain and BP elevation associated with higher plasma norepinephrine levels are in accordance with these findings. The subjects who had weight gain-related BP elevation also had higher frequencies of the Gly16 and Glu27 alleles compared with those without BP elevation, suggesting that Gly16/Glu27 is related to obesity-related hypertension. On the other hand, the frequency associations of the Arg16 or Gly16 alleles of the Arg16Gly and the Gln27 or Glu27 alleles of the Gln27Glu with the onset of hypertension and obesity are more controversial.6 The Glu27 receptor had been shown to be resistant to downregulation compared with Gln27 but when coexpressed with Arg16.29 We were not able to observe any significant association of the Arg16 and Glu27 alleles with weight gain or BP elevation, probably because of the small sample size of the study.
The ;3-adrenergic receptor system is important in mediating the stimulation of lipolysis by catecholamines in white adipose cells in humans and in the development of obesity.8–10 It is well documented that weight gain leads to BP elevation,1,15,16 but there are few investigations about the genetic relations in the ;3-adrenoceptor such as polymorphisms in Trp64Arg and the association of these polymorphisms with hypertension in obesity.30 Fujisawa et al23 have shown in a Japanese population that the allele frequency of Arg64 in hypertensive subjects was similar to that in normotensive subjects. Other investigators have reported in a large Japanese cohort (n=3706) that the subjects with the Arg64/Arg64 genotype had a greater BMI and percent fat mass than those with the in Trp64/Trp64 genotype.9 Conversely, we did not observe these associations in the genotype of the ;3-adrenoceptor in relation to weight gain-related BP elevation.
In the present study we used plasma norepinephrine levels as an index of SNA. Tuck,31 Grassi and Esler,32 and Rahn et al33 observed that there are different results in SNA values in hypertensive patients depending on the method of SNA measurement, including regional norepinephrine spillover, muscle sympathetic nerve activity (microneurography), and plasma norepinephrine measurements. Spillover methods are considered the "gold standard" for SNA measurements, but in humans these are difficult and invasive measurements. Plasma norepinephrine levels are more practical for large population studies and represent several different processes (secretion, clearance, and reuptake).3,15,16
It is known that Asian people (Japanese) have a lower definition of obesity than the World Health Organization BMI cutoff point for obesity (30 kg/m2),13,14 which is controlled by genotypes. In a Japanese population, a strong association between visceral fat content and the metabolic syndrome has been reported, as seen even in subjects defined as nonobese by BMI but who were obese by CT.34 In the present study the subjects who had the most significant weight gain and BP elevations also had a greater total body fat mass and waist-to-hip ratio plus higher plasma norepinephrine levels at entry, but BMI was not different between these entry groups. These findings suggest that abdominal obesity might be the link to heightened SNA, which is in part determined genetically by the abnormal ;-adrenoceptor polymorphism. Alvarez et al35,36 have reported that visceral obesity, but not subcutaneous obesity, is best associated with increased SNA. Grassi et al37 have also found that central obesity is characterized by greater sympathetic activation and impaired baroreceptor sensitivity than peripherally obese or lean subjects.
In summary, these findings are from the first large cohort-based longitudinal study analyzing the effect of genetic variation in the ;2- and ;3-adrenoceptor genes over a fixed time period, showing their strong association with initiation of weight gain and BP elevation. SNA, as seen in plasma norepinephrine accompanying abdominal obesity, may be the major mediator of the ;2-adrenoceptor gene changes.
References
Hubert HB, Feinleib M, McNamara PM, Castelli WP. Obesity as an independent risk factor for cardiovascular disease: a 26-year follow-up of participants in the Framingham Heart Study. Circulation. 1983; 67: 969–977.
Cui J, Hopper JL, Harrap SB. Genes and family environment explain correlations between blood pressure and body mass index. Hypertension. 2002; 40: 7–12.
Masuo K, Mikami H, Ogihara T, Tuck ML. Familial hypertension, insulin, sympathetic activity, and blood pressure elevation. Hypertension. 1998; 32: 96–100.
Masuo K, Mikami H, Ogihara T, Tuck ML. Familial obesity, sympathetic activation and blood pressure level. Blood Pressure. 2001; 10: 199–204.
Kato N, Sugiyama T, Morita H, Kurihara H, Sato T, Yamori Y, Yazaki Y. Association analysis of ;2-adrenergic receptor polymorphisms with hypertension in Japanese. Hypertension. 2001; 37: 286–292.
Pereira AC, Floriano MS, Mota GF, Cunha RS, Herkenhoff FL, Mill JG, Krieger JE. ;2 Adrenoceptor functional gene variants, obesity, and blood pressure level interactions in the general population. Hypertension. 2003; 42 (pt 2): 685–692.
van Rossum CT, Hoebee B, Seidell JC, Bouchard C, van Baak MA, de Groot CP, Chagnon M, de Graaf C, Saris WH. Genetic factors as predictors of weight gain in young adult Dutch men and women. Int J Obes Relat Metab Disord. 2002; 26: 517–528.
Clement K, Vaisse C, Manning BS, Basdevant A, Guy-Grand B, Ruiz J, Silver KD, Shuldiner AR, Froguel P, Strosberg AD. Genetic variation in the ;3-adrenergic receptor and an increased capacity to gain weight in patients with morbid obesity. N Engl J Med. 1995; 333: 352–354.
Oizumi T, Daimon M, Saitoh T, Kameda W, Yamaguchi H, Ohnuma H, Igarashi M, Eguchi H, Manaka H, Tominaga M, Kato T. Genotype Arg/Arg, but not Trp/Arg, of the Trp64Arg polymorphism of the ;3-adrenergic receptor is associated with type 2 diabetes and obesity in a large Japanese sample. Diabetes Care. 2001; 24: 1579–1583.
Strazzullo P, Iacone R, Siani A, Cappuccio FP, Russo O, Barba G, Barbato A, D’Elia L, Trevisan M, Farinaro E. Relationship of the Trp64Arg polymorphism of the beta3-adrenoceptor gene to central adiposity and high blood pressure: interaction with age: cross-sectional and longitudinal findings of the Olivetti Prospective Heart Study. J Hypertens. 2001; 19: 399–406.
Buettner R, Schaffler A, Arndt H, Rogler G, Nusser J, Zietz B, Enger I, Hugl S, Cuk A, Scholmerich J, Palitzsch KD. The Try64Arg polymorphism of the ;3-adrenergic receptor gene is not associated with obesity or type 2 diabetes mellitus in a large population-based Caucasian cohort. J Clin Endocrinol Metab. 1998; 83: 2892–2897.
Gagnon J, Mauriege P, Roy S, Sjostrom D, Chagnon YC, Dionne FT, Oppert JM, Perusse L, Sjostrom L, Bouchard C. The Trp64Arg mutation of the ;3 adrenergic receptor gene has no effect on obesity phenotypes in the Quebec Family Study and Swedish Obese Subjects cohorts. J Clin Invest. 1996; 98: 2086–2093.
WHO Expert Consultation. Appropriate body-mass index for Asian populations and its implications for policy and intervention strategies. Lancet. 2004; 363: 157–163.
Kanazawa M, Yoshiike N, Osaka T, Numba Y, Zimmet P, Inoue S. Criteria and classification of obesity in Japan and Asia-Oceania. Asia Pac J Clin Nutr. 2002; 11 (suppl 8): S732–S737.
Masuo K, Kawaguchi H, Mikami H, Ogihara T, Tuck ML. Serum uric acid and plasma norepinephrine concentrations predict subsequent weight gain and blood pressure elevation. Hypertension. 2003; 42: 474–480.
Masuo K, Mikami H, Ogihara T, Tuck ML. Weight gain-induced blood pressure elevation. Hypertension. 2000; 35: 1135–1140.
Willemsen JJ, Ross HA, Jacobs MC, Lenders JW, Thien T, Swinkels LM, Benraad TJ. Highly sensitive and specific HPLC with fluorometric detection for determination of plasma epinephrine and norepinephrine applied to kinetic studies in humans. Clin Chem. 1995; 41: 1455–1460.
Ranade K, Chang MS, Ting CT, Pei D, Hsiao CF, Olivier M, Pesich R, Hebert J, Chen YD, Dzau VJ, Curb D, Olshen R, Risch N, Cox DR, Botstein D. High-throughput genotyping with single nucleotide polymorphisms. Genome Res. 2001; 11: 1262–1268.
Kadowaki H, Yasuda K, Iwamoto K, Otabe S, Shimokawa K, Silver K, Walston J, Yoshinaga H, Kosaka K, Yamada N, Saito Y, Hagura R, Akanuma Y, Shuldiner A, Yazaki Y, Kadowaki T. A mutation in the ;3-adrenergic receptor gene is associated with obesity and hyperinsulinemia in Japanese subjects. Biochem Biophys Res Commun. 1995; 215: 555–560.
Walston J, Silver K, Bogardus C, Knowler WC, Celi FS, Austin S, Manning B, Strosberg AD, Stern MP, Raben N, Sorkin JD, Roth J, Shuldiner AR. Time of onset of non-insulin-dependent diabetes mellitus and genetic variation in the ;3-adrenergic-receptor gene. N Engl J Med. 1995; 333: 343–347.
Masuo K, Mikami H, Ogihara T, Tuck ML. Sympathetic nerve hyperactivity precedes hyperinsulinemia and blood pressure elevation in a young, nonobese Japanese population. Am J Hypertens. 1997; 10: 77–83.
Kawamura T, Egusa G, Fujikawa R, Okubo M. Gln27Glu variant of the beta2-adrenergic receptor gene is not associated with obesity and diabetes in Japanese-Americans. Metabolism. 2001; 50: 443–446.
Fujisawa T, Ikegami H, Yamato E, Hamada Y, Kamide K, Rakugi H, Higaki J, Murakami H, Shimamoto K, Ogihara T. trp64Arg mutation of beta3-adrenergic receptor in essential hypertension: insulin resistance and the adrenergic system. Am J Hypertens. 1997; 10: 101–105.
Large V, Hellstrom L, Reynisdottir S, Lonnqvist F, Eriksson P, Lannfelt L, Arner P. Human beta-2 adrenoceptor gene polymorphisms are highly frequent in obesity and associate with altered adipocyte beta-2 adrenoceptor function. J Clin Invest. 1997; 100: 3005–3013.
Castellano M, Rossi F, Giacche M, Perani C, Rivadossi F, Muiesan ML, Salvetti M, Beschi M, Rizzoni D, Agabiti-Rosei E. ;2-Adrenergic receptor gene polymorphism, age, and cardiovascular phenotypes. Hypertension. 2003; 41: 361–367.
Timmermann B, Mo R, Luft FC, Gerdts E, Busjahn A, Omvik P, Li GH, Schuster H, Wienker TF, Hoehe MR, Lund-Johansen P. Beta2-adrenoceptor genetic variation is associated with genetic predisposition to essential hypertension: the Bergen Blood Pressure Study. Kidney Int. 1998; 53: 1455–1460.
Gratze G, Fortin J, Labugger R, Binder A, Kotanko P, Timmermann B, Luft FC, Hoehe MR, Skrabal F. ;2-Adrenergic receptor variants affect resting blood pressure and agonist-induced vasodilation in young adult Caucasians. Hypertension. 1999; 33: 1425–1430.
Green SA, Turki J, Innis M, Liggett SB. Amino-terminal polymorphisms of the human ;2-adrenergic receptor impart distinct agonist-promoted regulatory properties. Biochemistry. 1994; 33: 9414–9419.
Martinez FD, Graves PE, Baldini M, Solomon S, Erickson R. Association between genetic polymorphisms of the beta2-adrenoceptor and response to albuterol in children with and without a history of wheezing. J Clin Invest. 1997; 100: 3184–3188.
Melis MG, Secchi G, Brizzi P, Severino C, Maioli M, Tonolo G. The Trp64Arg beta3-adrenergic receptor amino acid variant confers increased sensitivity to the pressor effects of noradrenaline in Sardinian subjects. Clin Sci (Lond). 2002; 103: 398–402.
Tuck ML. The sympathetic nervous system in essential hypertension. Am Heart J. 1986; 112: 877–886.
Grassi G, Esler M. How to assess sympathetic activity in humans. J Hypertens. 1999; 17: 719–734.
Rahn KH, Barenbrock M, Hausberg M. The sympathetic nervous system in the pathogenesis of hypertension. J Hypertens. 1999; 17 (suppl 3): S11–S14.
Nagaretani H, Nakamura T, Funahashi T, Kotani K, Miyanaga M, Tokunaga K, Takahashi M, Nishizawa H, Kishida K, Kuriyama H, Hotta K, Yamashita S, Matsuzawa Y. Visceral fat is a major contributor for multiple risk factor clustering in Japanese men with impaired glucose tolerance. Diabetes Care. 2001; 24: 2127–2133.
Alvarez GE, Ballard TP, Beske SD, Davy KP. Subcutaneous obesity is not associated with sympathetic neural activation. Am J Physiol. 2004; 287: H414–H418.
Alvarez GE, Beske SD, Ballard TP, Davy KP. Sympathetic neural activation in visceral obesity. Circulation. 2002; 106: 2533–2536.
Grassi G, Dell’Oro R, Facchini A, Quarti Trevano F, Bolla GB, Mancia G. Effect of central and peripheral body fat mass distribution on sympathetic and baroreflex function in obese normotensives. J Hypertens. 2004; 22: 2363–2369.
Is sildenafil effective for treating pulmonary hypertension after pediatric heart surgery
Cyanosis in atrial septal defect without pulmonary hypertension: a case of Platypnea-orthodeoxya syndrome
Antihypertensive Medication Use Among US Adults With Hypertension
Activation of Soluble Guanylate Cyclase Reverses Experimental Pulmonary Hypertension and Vascular Remodeling
Hypertension in Sub-Saharan African Populations
Cost-Effectiveness Analysis of Hypertension Guidelines in South Africa
Corin Gene Minor Allele Defined by 2 Missense Mutations Is Common in Blacks and Associated With High Blood Pressure and Hypertension
Nox1 Overexpression Potentiates Angiotensin II-Induced Hypertension and Vascular Smooth Muscle Hypertrophy in Transgenic Mice
Nox1 Is Involved in Angiotensin II–Mediated Hypertension
Antihypertensive Effects of Drospirenone With 17-Estradiol, a Novel Hormone Treatment in Postmenopausal Women With Stage 1 Hypertension