the Institute of Endocrinology, Metabolism and Hypertension (D.S., R.L., O.S., E.K., N.S.) and the Metabolic Bone Disease Unit (Y.W., N.J.)
Tel Aviv Sourasky Medical Centre and Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv
Department of Biological Regulation (F.K., B.G.), Weizmann Institute of Science, Rehovot, Israel.
Abstract
Background— 1,25(OH)2 vitamin D3 exerts multiple effects in human vascular smooth muscle cells (VSMCs). We therefore tested the possibility that VSMCs possess an endogenous 25-hydroxyvitamin D3-1-hydroxylase system, the final enzyme in the biosynthetic pathway of 1,25(OH)2D3.
Methods and Results— We assessed the expression and activity of 25-hydroxyvitamin D3-1-hydroxylase by real-time polymerase chain reaction and the conversion of 25(OH)D3 into 1,25(OH)2D3. First, 25-hydroxyvitamin D3-1-hydroxylase mRNA was identified in cultured VSMCs by real-time polymerase chain reaction. Second, in cells treated daily (3 days) with parathyroid hormone (66 nmol/L), estradiol-17; (30 nmol/L), raloxifene (3 μmol/L), and the phytoestrogens genistein (3 μmol/L), biochainin A (3 μmol/L), and 6-carboxy biochainin A (30 nmol/L), 25-hydroxyvitamin D3-1-hydroxylase mRNA increased by 43±13%, (P<0.05) 7±24% (P=NS), 176±28% (P<0.01), 65±11% (P<0.05), 152±24% (P<0.01), and 71±9% (P<0.05), respectively. Third, production of 1,25(OH)2D3 from 25(OH)D3 was seen with a Km of 25 ng/mL and increased dose dependently after treatment with parathyroid hormone, genistein, and the phytosetrogen derivative 6-carboxy biochainin A. Estradiol-17; and biochainin A also increased the generation of 1,25(OH)2D3 by 40±23% (P<0.05) and 55±13% (P<0.05), respectively.
Conclusions— We provide here the first evidence for the expression of an enzymatically active 25(OH)D3-1-hydroxylase system in human VSMCs, which can be upregulated by parathyroid hormone and estrogenic compounds. Because exogenous vitamin D inhibits VSMC proliferation, the role of this system as an autocrine mechanism to curb changes in VSMC proliferation and phenotype is a subject for future investigation.
Key Words: molecular biology ; vitamin D ; vasculature ; muscle, smooth ; parathyroid hormone
Introduction
There is growing interest in the potential role of vitamin D metabolites in the vasculature. Both endothelial cells and vascular smooth muscle cells (VSMCs) express high-affinity receptors for 1,25(OH)2 vitamin D3,1,2 and vitamin D metabolites exert numerous effects in VSMCs3–10 that involve vital aspects of VSMC function and pathology, including contractility, growth and migration, and the evolution of vascular calcifications. Vitamin D metabolites appear to enhance the expression of Ca-ATPase,3 increase the entry of calcium into the cell,4 raise cytosolic free calcium,5 induce the expression of contractile proteins,6 and accelerate the formation of prostacyclin7 in VSMCs, all of which may directly or indirectly affect arterial tone. Evidence also suggests that 1,25(OH)2 vitamin D3 inhibits VSMC replication8,9 and diminishes the mitogenic response to growth enhancers such as thrombin or platelet-derived growth factor (PDGF).9 On the other hand, 1,25(OH)2 vitamin D3 may accelerate cell migration10 and promote the transition of contractile VSMCs into a secretory cell phenotype.11 Finally, 1,25(OH)2D3 has been linked to the formation of arterial calcifications in a complex and poorly understood manner; although hypervitaminosis D induces vascular calcifications12,13 and 1,25(OH)2 vitamin D3 increases the expression of bone proteins such as osteopontin in VSMCs,10,13 coronary calcifications appear to be inversely related to circulating 1,25(OH)2 vitamin D3.14 Furthermore, a consistent association between osteoporosis and vascular calcification has been noted in a number of reports.15,16
See p 1571
Although it is possible that all the aforementioned interactions between 1,25(OH)2D3 and the vasculature are exerted exclusively via the active form of the circulating vitamin, the scope of the induced effects of 1,25(OH)2 vitamin D3 and their potential significance for vascular function and structure are large enough to raise the possibility that an intracellularly produced hormone may better fit the need for coordinated regulation of these multiple effects in VSMCs than the circulating vitamin, which is regulated entirely by systemic calcium homeostatic factors. Indeed, a recent publication indicated that 25(OH)D3-1-hydroxylase is expressed in endothelial cells,17 in which it appears to modulate cell growth17,18 and increase monocyte adhesion.18 Given the high circulating levels of 25(OH)D3, the precursor of 1,25(OH)2D3, we reasoned that a locally expressed 25(OH)D3-1-hydroxylase system might enable VSMCs to regulate the concentrations of 1,25(OH)2D3 in an autocrine and/or paracrine manner so that it can be governed by local factors and provide intracellular ligands for the VSMC vitamin D receptor. In the present study, we show that functional 25(OH)D3-1-hydroxylase is indeed expressed in cultured human VSMCs and that it can be regulated by parathyroid hormone (PTH) and by several estrogenic compounds.
Methods
Cell Culture
VSMCs were prepared from human umbilical artery as previously described with minor modifications.19,20 In brief, umbilical cords were collected shortly after delivery, and arteries were dissected, cleaned of blood and adventitia, and cut into tiny slices (1 to 3 mm). The segments were kept in culture in medium 199 containing 20% FCS, glutamine, and antibiotics. Cell migration was detected within 5 to 7 days. Cells were fed twice a week; on confluence, they were trypsinized and transferred to 24-well dishes. Cells were used only at passages 1 through 3 when expression of smooth muscle actin was clearly demonstrable.
25-Hydroxyvitamin D3-1-Hydroxylase mRNA Expression in VSMCs
Total RNA from cultured VSMCs was extracted with the Trizol Reagent (Gibco). An aliquot of 1 μg RNA from each sample was reverse transcribed (RT) with the Advantage RT for polymerase chain reaction (PCR) kit (Clonthec), as previously described.19 25(OH)D3-1-OH-hydroxylase mRNA levels were analyzed with the ABI 7700 sequence detection system. Amplification of its cDNA was performed in 25 μL on 96-well plates in a reaction buffer containing Taqman universal PCR master mixture. The sequences of nucleotides were as follows: forward primer, CACCCGACACGGAGACCTT; reverse primer, TCAACAGCGTGGACACAAACA; and Taqman probe, TCCGCGCTGTGGGCTCGG. RnaseP expression served as an internal control for each sample and was performed by assay-on-demand gene expression products, which consist of a x20 mixture of unlabeled PCR primers and Taqman MGB probe labeled with 5 carboxy fluorescein dye. Measurements were performed in triplicate. The PCR conditions were as follows: 50°C for 2 minutes, 95°C for 10 minutes, 50 cycles of 95°C for 15 seconds, and 60°C for 1 minute. The total volume of the reaction was 25 μL: 12.5 μL universal master mix, 1.25 μL x20 assay-on-demand mix, and 11.25 μL cDNA.
Assessment of 25-Hydroxyvitamin D3-1-Hydroxylase Activity in VSMCs
25-Hydroxyvitamin D3-1-hydroxylase activity was assessed by measurement of 1,25(OH)2D3 generated within 60 minutes after the addition of 25(OH)D3 (200 ng/mL) to culture with the 1,25-Dihydroxyvitamin D125-I radioimmunoassay kit from DiaSorin.
Preparation of Estradiol Macromolecular Conjugates
Estradiol- 6-(O)-carboxymethyl oxime (E2-6-CMO)21 was prepared by conjugating E2 to carboxymethylamine hemihydrochloride. The nature of the conjugate was confirmed by thin-layer chromatography.21 E2-6-CMO was conjugated to ovalbumin (Ov) via a 2-step reaction as described previously.21,22 In the first step, E2-6-CMO was conjugating in dry dioxane with N-hydroxysuccinimide and carbodi-imide. In the second step, the N-hydroxysuccinimide ester derivative of E2-6-CMO in dioxane was bound to Ov. Analysis of the compound indicated that it was free of E2-6-CMO and E2.21,22 Conjugates of daidzein with Ov (carboxymethyl daidzein Ov [cD-Ov]), genistein with Ov (carboxymethyl genistein Ov [cG-Ov]), and biochainin A (BA) with Ov (carboxymethyl biochainin A Ov [cBA-Ov]) were prepared like that of E2-Ov and as previously described.21
Assessment of DNA Synthesis
Cells were grown until subconfluence and then treated with various hormones as indicated. Twenty-two hours later, [3H] thymidine was added for 2 hours. Cells were then treated with 10% ice-cold trichloroacetic acid for 5 minutes and washed twice with 5% trichloroacetic acid and then with cold ethanol. The cellular layer was dissolved in 0.3 mL of 0.3N NaOH; samples were aspirated; and [3H] thymidine incorporation into DNA was determined.8
Creatine Kinase Extraction and Assay
To compare the effect of the various hormones on growth with the more classic effects of E2, we measured creatine kinase (CK) brain-type specific activity, an established genomic response marker of E2. Cells were treated for 24 hours with the various hormones as specified and were then scraped off the culture dishes and homogenized by freezing and thawing 3 times in an extraction buffer as previously described.8 Supernatant extracts were obtained by centrifugation of homogenates at 14 000g for 5 minutes at 4°C in an Eppendorf microcentrifuge. CK activity was assayed by a coupled spectrophotometric assay described previously.8 Protein was determined by Coomasie blue dye binding with BSA as the standard.
Statistical Analysis
Differences between the mean values obtained from the experimental and control groups were evaluated by ANOVA. A value of P<0.05 was considered significant.
Results
Enzymatic Conversion of 25(OH)D3 Into 1,25(OH)2D3 in VSMCs (25-Hydroxyvitamin D3-1-Hydroxylase Activity)
Basal production of 1,25(OH)2D3 in cultured VSMCs was 1.25+0.18 pmol · mg–1 protein · 60 min–1 (Figure 1). When VSMCs were incubated for 60 minutes with increasing concentrations of 25(OH)D3 ranging from 10 ng/mL to 500 ng/mL, the concentrations of produced 1,25(OH)2D3 increased dose dependently as a function of added 25(OH)D3, reaching a plateau at 200 ng/mL, with a Km of 25 ng/mL.
Effect of PTH and Estrogenic Compounds on the Enzymatic Conversion of 25(OH)D3 Into 1,25(OH)2D3 in VSMCs
The effects of various agents on 25-hydroxyvitamin D3-1-hydroxylase activity were assessed by measuring the concentration of 1,25(OH)2D3 formed in the presence of 25-hydroxyvitamin D3 (200 ng/mL) and various concentrations of the added hormones. As shown in Figure 2 (bottom), PTH (1-84) increased the formation of 1,25(OH)2D3 under these conditions in a dose-related fashion, reaching a plateau at a PTH concentration of 62.5 nmol/L.
We also examined the effects of several estrogenic compounds on 25-hydroxyvitamin D3-1-hydroxylase activity. In particular, we examined in detail the effect of genistein (Figure 2, top), the best-studied phytoestrogen, and cBA (Figure 2, middle), a synthetic derivative of the isoflavone BA generated by the introduction of a carboxymethyl group at the 6 position of the isoflavone BA, because these compounds exhibit estrogenic properties21,23 and cannot be "aromatized" into an androgen. The effects of cBA and genistein on 25-hydroxyvitamin D3-1-hydroxylase activity are shown in Figures 3 and 4. Both agents increased 1,25(OH)2D3 synthesis in a dose-related manner. Of note is the steep rise induced by cBA at the nanomolar range, reaching a plateau at a cBA concentration of 6 nmol/L.
Likewise, E2, BA, and cBA induced a significant increase in 25-hydroxyvitamin D3-1-hydroxylase activity when used at concentrations previously shown to maximally affect DNA synthesis and CK activity in this system of VSMCs.21,22 The observed increments in 1,25(OH)2D3 concentration were 40±23% (P<0.05), 55+13% (P<0.05), and 47±13% (P<0.05) for E2, BA, and genistein, respectively (Figure 3). Additionally, the noncalcemic synthetic analog of 1,25(OH)2D3 JKF also increased 1,25(OH)2D3 production by 83±13% (P<0.01) (Figure 3).
Because some of the effects of phytoestrogens on VSMC growth are exerted via membrane receptors,24 we examined the effects of E2, cG, cD, and cBA either as free molecules or as conjugates to macroproteins incapable of traversing the cell membrane and E2-Ov, cG-Ov, cD-Ov, and cBA-Ov on 1,25(OH)2D3 synthesis. As shown in Figure 4, when conjugated to macroproteins, neither of these compounds (each eliciting an increase in production when incubated as a free hormone) was capable of affecting 1,25(OH)2D3 production.
Expression of 25-Hydroxyvitamin D3-1-Hydroxylase mRNA in VSMCs
Using real-time PCR and the primers specified in Materials and Methods, we identified 25-hydroxyvitamin D3-1-hydroxylase mRNA expression in all RNA extracts of 7 different VSMC preparations tested. Furthermore, in cells treated daily (3 days) with PTH (1-84) (66 nmol/L), raloxifene (3 μmol/L), genistein (3 μmol/L), BA (3 μmol/L), or cBA (0.03 μmol/L), 25-hydroxyvitamin D3-1-hydroxylase mRNA increased by 43±13% (P<0.05), 176±28% (P<0.01), 65±11% (P<0.05), 152±24% (P<0.01), and 71±9% (P<0.05), respectively.
In contrast, the vitamin D analog JKF (1 nmol/L) or angiotensin II (not shown) had no effect on 25-hydroxyvitamin D3-1-hydroxylase mRNA expression (Figure 3).
Effects of 1,25(OH)2D3 on 3[H] Thymidine Incorporation Into DNA and CK Specific Activity in VSMCs
When subconfluent cells were treated with 1,25(OH)2D3 (0.001 to 10 nmol/L), DNA synthesis as assessed by [3H] thymidine incorporation was inhibited in a dose-dependent fashion (Figure 5). Under the same experimental conditions, 1,25(OH)2D3 induced a dose-related change in VSMC CK specific activity (Figure 5): CK gradually increased as the 1,25(OH)2D3 concentration was raised from 0.001 to 0.01 nmol/L, leveled off at 0.01 to 0.1 nmol/L, and declined toward baseline activity at a 1,25(OH)2D3 concentration of 1 to 10 nmol/L.
Discussion
The synthesis of 1,25(OH)2D3 from its precursor, 25(OH)D3, is catalyzed by 25-hydroxyvitamin D3-1-hydroxylase, an enzyme most abundantly expressed in epithelial cells making up various parts of the human nephron.25 Renal 25-hydroxyvitamin D3-1-hydroxylase is subject to tight systemic metabolic control by PTH, calcium, phosphate, and vitamin D3 metabolites, predominantly 1,25(OH)2D3 itself. Nevertheless, extrarenal production of 1,25(OH)2D3 and/or discrete expression of 1-hydroxylase is now well documented in several other human cell types, including macrophages, lymphocytes, basal keratinocytes, colon epithelial cells and parasympathetic ganglia, pancreatic islet cells, adrenal medullary cells, and cerebellar and cerebral cortical cells.6 Although the function of 1-hydroxylase in many of these extrarenal tissues is currently undefined, it appears that 1-hydroxylase is differentially regulated at least in some of these sites. For example, 1-hydroxylase in macrophages is sensitive to immune signals such as interferon-, tumor necrosis factor-, and lipopolysaccharide26–31 rather than to systemic calcium homeostatic signals.32
VSMCs are clearly sensitive to the effects of the circulating calcitrophic hormones 1,25(OH)2D3 and PTH. PTH has long been recognized as a potent vasodilator hormone that stimulates VSMC adenylate cyclase activity.33,34 More recent observations suggest that PTH increases VSMC proliferation and augments the synthesis of MCP-1, collagen, and ;-1 integrin.35,36 If these observations are taken together with the recent discovery that VSMCs produce PTH-related protein (PTH-rP) and that the local expression of this peptide is controlled by 1,25(OH)2D3,37,38 it would appear that a locally regulated generation of 1,25(OH)2D3 and PTH-rP in VSMCs might protect blood vessels from the effects of variations in circulating 1,25(OH)2D3 and PTH that are entirely unaffected by factors originating in or sensitive to the vasculature per se.
In the present study, we provide evidence for such system of generation of the active metabolite of vitamin D in cultured human VSMCs. First, the synthesis of 1,25(OH)2D3 in VSMCs is quantitatively significant at a basal production rate of 1 pmol/mg protein, reaching 3 pmol · h–1 · mg–1 protein under saturating concentrations of its substrate, 25(OH)D3. This is fairly comparable to but somewhat higher than the reported level of 1,25(OH)2D3 production by cultured primary human umbilical vein endothelial cells (400 fmol · h–1 · mg–1 protein17). Second, because the Km for 1,25(OH)2D3 generation in VSMCs is 25 ng/mL of 25(OH)D3, which is about the usual concentration of 25(OH)D3 in humans, small changes in circulating 25(OH)D3 may translate into large alterations in generated 1,25(OH)2D3. Thus, regulation of VSMC 25-hydroxyvitamin D3-1-hydroxylase expression and activity by PTH and several phytoestrogens, as shown in Figures 2 through 4, offer a potentially important mechanism to further modulate the intracellular production rate of 1,25(OH)2D3.. Although PTH per se affects VSMC, PTH-rP, which is produced in VSMCs and interacts with PTH receptors, may affect 1,25(OH)2D3 in a paracrine/autocrine fashion. Furthermore, locally generated 1,25(OH)2D3 can feed back to inhibit PTH-rP production in VSMCs.38 Moreover, we report here that 1,25(OH)2D3 inhibits VSMC cell growth and at the same time increases metabolic turnover as assessed by CK activity, thus underscoring the potential physiological implications of an intracellular 1,25(OH)2D3-generating system in these cells.
That phytoestrogens can modulate 25-hydroxyvitamin D3-1-hydroxylase expression and activity in VSMCs is in accord with recent observations in human mammary and prostate cells in which genistein was shown to exert a concentration-dependent increase in the expression of this enzyme.39,40 It is also consistent with observations that estrogen increases circulating levels of 1,25(OH)2D3 in postmenopausal women41 and in pubertal girls,42 although the mechanism underlying these in vivo changes remains unexplored. Of note, however, is the finding that the phytoestrogen derivatives, particularly cBA, were particularly potent in upregulating 25-hydroxyvitamin D3-1-hydroxylase expressions and activity. These observations add to the complexity of the known interactions of phytoestrogens in the vasculature.43 Although the effects of all phytoestrogens tested here on 25-hydroxyvitamin D3-1-hydroxylase activity are stimulatory, the phytoestrogens exert diverse effects on cell growth; eg, BA and cBA increase DNA synthesis in VSMCs, and similar concentrations of genistein actually inhibit DNA synthesis in VSMCs.21–23,42 The increase in 25-hydroxyvitamin D3-1-hydroxylase activity induced by E2, cBA, and BA also requires the steroid molecule to enter the cell because it cannot be reproduced by the macroprotein conjugates of E2 or the phytoestrogens that are incapable of traversing the cell membrane. Hence, these effects on 25-hydroxyvitamin D3-1-hydroxylase appear to be mediated through classic genomic effects. In contrast, some of the effects of phytoestrogens on growth can be elicited by the compounds in their conjugated form and thus are likely mediated through membrane-dependent pathways.24
In conclusion, we provide the first evidence for the expression of an enzymatically active 25-hydroxyvitamin D3-1-hydroxylase system in human VSMCs that can be upregulated by PTH and by native and synthetic phytoestrogens. Because exogenous vitamin D inhibits VSMC proliferation, the potential role of this system as an autocrine mechanism to modulate VSMC growth and differentiation should be the subject of future investigation.
References
Merke J, Hofmann W, Goldschmidt D, Ritz E. Demonstration of 1,25(OH)2 vitamin D3 receptors and actions in vascular smooth muscle cells in vitro. Calcif Tissue Int. 1987; 41: 112–114.
Rajasree S, Umashankar PR, Lal AV, Sarma PS, Kartha CC. 1,25-Dihydroxyvitamin D3 receptor is upregulated in aortic smooth muscle cells during hypervitaminosis D. Life Sci. 2002; 70: 1777–1788.
Kawashima H. 1,25-Dihydroxyvitamin D3 stimulates Ca-ATPase in a vascular smooth muscle cell line. Biochem Biophys Res Commun. 1988; 150: 1138–1143.
Inoue T, Kawashima H. 1,25-Dihydroxyvitamin D3 stimulates 45Ca2+-uptake by cultured vascular smooth muscle cells derived from rat aorta. Biochem Biophys Res Commun. 1988; 152: 1388–1394.
Shan J, Resnick LM, Lewanczuk RZ, Karpinski E, Li B, Pang PK. 1,25-Dihydroxyvitamin D as a cardiovascular hormone: effects on calcium current and cytosolic free calcium in vascular smooth muscle cells. Am J Hypertens. 1993; 6: 983–988.
Ishibashi K, Evans A, Shingu T, Bian K, Bukoski RD. Myosin isoform expression and force generation in cultured resistance arteries. Am J Physiol. 1997; 272: C1144–C1150.
Wakasugi M, Noguchi T, Inoue M, Kazama Y, Tawata M, Kanemaru Y, Onaya T. Vitamin D3 stimulates the production of prostacyclin by vascular smooth muscle cells. Prostaglandins. 1991; 42: 127–136.
Somjen D, Kohen F, Amir-Zaltsman Y, Knoll E, Stern N. Vitamin D analogs modulate the action of gonadal steroids in human vascular cells in vitro. Am J Hypertens. 2000; 13: 396–403.
Mitsuhashi T, Morris RC Jr, Ives HE. 1,25-Dihydroxyvitamin D3 modulates growth of vascular smooth muscle cells. J Clin Invest. 1991; 87: 1889–1895.
Rebsamen MC, Sun J, Norman AW, Liao JK. 1alpha,25-dihydroxyvitamin D3 induces vascular smooth muscle cell migration via activation of phosphatidylinositol 3-kinase. Circ Res. 2002; 91: 17–24.
Tukaj C, Kubasik-Juraniec J, Kraszpulski M. Morphological changes of aortal smooth muscle cells exposed to calcitriol in culture. Med Sci Monit. 2000; 6: 668–674.
Kahonen M, Nappi S, Jolma P, Hutri-Kahonen N, Tolvanen JP, Saha H, Koivisto P, Krogerus L, Kalliovalkama J, Porsti I. Vascular influences of calcium supplementation and vitamin D–induced hypercalcemia in NaCl-hypertensive rats. J Cardiovasc Pharmacol. 2003; 42: 319–328.
Price PA, Williamson MK, Nguyen TM, Than TN. Serum levels of the fetuin-mineral complex correlate with artery calcification in the rat. J Biol Chem. 2004; 279: 1594–1600.
Watson KE, Abrolat ML, Malone LL, Hoeg JM, Doherty T, Detrano R, Demer LL. Active serum vitamin D levels are inversely correlated with coronary calcification. Circulation. 1997; 96: 1755–1760.
Hak AE, Pols HA, van Hemert AM, Hofman A, Witteman JC. Progression of aortic calcification is associated with metacarpal bone loss during menopause: a population-based longitudinal study. Arterioscler Thromb Vasc Biol. 2000; 20: 1926–1931.
Tanko LB, Bagger YZ, Christiansen C. Low bone mineral density in the hip as a marker of advanced atherosclerosis in elderly women. Calcif Tissue Int. 2003; 73: 15–20.
Zehnder D, Bland R, Chana RS, Wheeler DC, Howie AJ, Williams MC, Stewart PM, Hewison M. Synthesis of 1,25-dihydroxyvitamin D(3) by human endothelial cells is regulated by inflammatory cytokines: a novel autocrine determinant of vascular cell adhesion. J Am Soc Nephrol. 2002; 13: 621–629.
Mantell DJ, Owens PE, Bundred NJ, Mawer EB, Canfield AE. 1,25-Dihydroxyvitamin D(3) inhibits angiogenesis in vitro and in vivo. Circ Res. 2000; 87: 214–220.
Limor R, Weisinger G, Gilad S, Knoll E, Sharon O, Jaffe A, Kohen F, Berger E, Lifschizt-Mercer B, Stern N. A novel form of platelet-type 12-lipoxygenase mRNA in human vascular smooth muscle cells. Hypertension. 2000; 38: 864–871.
Somjen D, Kohen F, Jaffe A, Amir-Zaltsman Y, Knoll E, Stern N. Effects of gonadal steroids and their antagonist on DNA synthesis in human vascular cells. Hypertension. 1998; 32: 39–45.
Somjen D, Amir-Zaltsman Y, Gayer B, Kulik T, Knoll E, Stern N, Lu LJ, Toldo L, Kohen F. 6-Carboxymethyl genistein: a novel selective oestrogen receptor modulator (SERM) with unique, differential effects on the vasculature, bone and uterus. J Endocrinol. 2002; 173: 415–427.
Somjen D, Kohen F, Lieberherr M, Gayer B, Schejter E, Kaye A M, Katzburg S, Limor R, Sharon O, Knoll E, Posner GH, Stern N. Effects of phytoestrogens and carboxy derivatives of phytoestrogens on human vascular and bone cells: new insights based on studies with caboxy-biochanin A. J Steroid Biochem Mol Biol. In press.
Somjen D, Stern N, Knoll E, Sharon O, Gayer B, Kulik T, Kohen F. Carboxy derivatives of isoflavones as affinity carriers for cytotoxic drug targeting in adrenocortical H295R carcinoma cells. J Endocrinol. 2003; 179: 395–403.
Somjen D, Kohen F, Gayer B, Sharon O, Baz M, Limor R, Kulik T, Knoll E, Stern N. Role of putative membrane receptors in the effects of estradiol on human vascular cell growth. Am J Hypertens. 2004; 17: 462–469.
Zehnder D, Bland R, Walker EA, Bradwell AR, Howie AJ, Hewison M, Stewart PM. Expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in the human kidney. J Am Soc Nephrol. 1999; 10: 2465–2473.
Zehnder D, Bland R, Williams MC, McNinch RW, Howie AJ, Stewart PM, Hewison M. Extrarenal expression of 25-hydroxyvitamin d(3)-1 alpha-hydroxylase. J Clin Endocrinol Metab. 2001; 86: 888–894.
Koeffler HP, Reichel H, Bishop JE, Norman AW. Alpha-Interferon stimulates production of 1,25-dihydroxyvitamin D3 by normal human macrophages. Biochem Biophys Res Commun. 1985; 127: 596–603.
Reichel H, Koeffler HP, Barbers R, Norman AW. Regulation of 1,25-dihydroxyvitamin D3 production by cultured alveolar macrophages from normal human donors and from patients with pulmonary sarcoidosis. J Clin Endocrinol Metab. 1987; 65: 1201–1209.
Reichel H, Koeffler HP, Norman AW. Synthesis in vitro of 1,25-dihydroxyvitamin D3 and 24,25-dihydroxyvitamin D3 by interferon –stimulated normal human bone marrow and alveolar macrophages. J Biol Chem. 1987; 262: 10931–10937.
Reichel H, Koeffler HP, Bishop JE, Norman AW. 25-Hydroxyvitamin D3 metabolism by lipopolysaccharide-stimulated normal human macrophages. J Clin Endocrinol Metab. 1987; 64: 1–9.
Pryke AM, Duggan C, White CP, Posen S, Mason RS. Tumor necrosis factor- induces vitamin D-1-hydroxylase activity in normal human alveolar macrophages. J Cell Physiol. 1990; 142: 652–656.
Yokomura K, Suda T, Sasaki S, Inui N, Chida K, Nakamura H. Increased expression of the 25-hydroxyvitamin D(3)-1alpha-hydroxylase gene in alveolar macrophages of patients with lung cancer. J Clin Endocrinol Metab. 2003; 88: 5704–5709.
Hanson AS, Linas SL. Parathyroid hormone/adenylate cyclase coupling in vascular smooth muscle cells. Hypertension. 1994; 23: 468–475.
Schluter KD, Piper HM. Cardiovascular actions of parathyroid hormone and parathyroid hormone–related peptide. Cardiovasc Res. 1998; 37: 34–41.
Martin-Ventura JL, Ortego M, Esbrit P, Hernandez-Presa MA, Ortega L, Egido J. Possible role of parathyroid hormone–related protein as a proinflammatory cytokine in atherosclerosis. Stroke. 2003; 34: 1783–1789.
Perkovic V, Hewitson TD, Kelynack KJ, Martic M, Tait MG, Becker GJ. Parathyroid hormone has a prosclerotic effect on vascular smooth muscle cells. Kidney Blood Press Res. 2003; 26: 27–33.
Jono S, Nishizawa Y, Shioi A, Morii H. Parathyroid hormone–related peptide as a local regulator of vascular calcification: its inhibitory action on in vitro calcification by bovine vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 1997; 17: 1135–1142.
Jono S, Nishizawa Y, Shioi A, Morii H. 1,25-Dihydroxyvitamin D3 increases in vitro vascular calcification by modulating secretion of endogenous parathyroid hormone–related peptide. Circulation. 1998; 98: 1302–1306.
Kallay E, Adlercreutz H, Farhan H, Lechner D, Bajna E, Gerdenitsch W, Campbell M, Cross HS. Phytoestrogens regulate vitamin D metabolism in the mouse colon: relevance for colon tumor prevention and therapy. J Nutr. 2002; 132: 3490S–3493S.
Cross HS, Kallay E, Lechner D, Gerdenitsch W, Adlercreutz H, Armbrecht HJ. Phytoestrogens and vitamin D metabolism: a new concept for the prevention and therapy of colorectal, prostate, and mammary carcinomas. J Nutr. 2004; 134: 1207S–1212S.
Cheema C, Grant BF, Marcus R. Effects of estrogen on circulating "free" and total 1,25-dihydroxyvitamin D and on the parathyroid-vitamin D axis in postmenopausal women. J Clin Invest. 1989; 83: 537–542.
Aarskog D, Aksnes L, Markestad T, Rodland O. Effect of estrogen on vitamin D metabolism in tall girls. J Clin Endocrinol Metab. 1983; 57: 1155–1158.
Somjen D, Knoll E, Kohen F, Stern N. Effects of phytoestrogens on DNA synthesis and creatine kinase activity in vascular cells. Am J Hypertens. 2001; 14: 1256–1262.
Identification of a Small Molecular Anti-HIV-1 Compound that Interferes with Formation of the Fusion -active gp41 Core
Should patients post-cardiac surgery be given low molecular weight heparin for deep vein thrombosis prophylaxis
Angiographic and Clinical Outcomes in Patients Receiving Low-Molecular-Weight Heparin Versus Unfractionated Heparin in ST-Elevation Myocardial Infarction Treated With Fibrinolytics in the CLARITY-TIMI
Unfractionated and Low-Molecular-Weight Heparin as Adjuncts to Thrombolysis in Aspirin-Treated Patients With ST-Elevation Acute Myocardial Infarction
Molecular Basis of Arrhythmias
Molecular Regulation of Platelet-Dependent Thrombosis
Molecular Profiling of Heart Endothelial Cells
Molecular Magnetic Resonance Imaging of Atrial Clots in a Swine Model
Novel Molecular Mechanism Involving 1D (Cav1.3) L-Type Calcium Channel in Autoimmune-Associated Sinus Bradycardia
Assessment of Endogenous and Therapeutic Arteriogenesis by Contrast Ultrasound Molecular Imaging of Integrin Expression