您的位置: 百康网 > 期刊 > 内科学 > 《内分泌学杂志》 > 2005年1月第1期 > 正文
11-Deoxycorticosterone Is a Potent Agonist of the Rainbow Trout (Oncorhynchus mykiss) Mineralocorticoid Receptor
http://www.100kang.com 2007-5-7 16:29:01 11-Deoxycorticosterone


Station Commune de Recherche en Ichtyophysiologie, Biodiversité et Environnement (A.S., L.D., P.P.), Institut National de la Recherche Agronomique, Institut Fedératif de Recherche 98, 35042 Rennes-Cedex, France; King’s College London (A.S., N.B.), Division of Life Sciences, London SE1 9NN, United Kingdom; Institut National de la Santé et de la Recherche Médicale U478 (J.F., M.E.R.-O.), Institut Fédératif de Recherche 02, Faculté de Médecine Xavier Bichat, 75870 Paris Cedex 18, France; Equipe d’Endocrinologie Moléculaire de la Reproduction (G.F.), Unité Mixte de Recherche Centre National de la Recherche Scientifique 6026, Universite de Rennes I, 35042 Rennes-Cedex, France

Address all correspondence and requests for reprints to: P. Prunet, Institut National de la Recherche Agonomique SCRIBE, Campus de Beaulieu, 35042 Rennes-Cedex, France.

Abstract

The teleost fish are thought to lack the mineralocorticoid hormone aldosterone but possess mineralocorticoid receptor (MR) homologs. Here we describe the characterization of two rainbow trout (Oncorhynchus mykiss) MRs, called rtMRa and rtMRb. The open reading frame of rtMRa cDNA encoded a protein of 1041 amino acids. The rtMRb predicted protein sequence is similar, differing in only 10 amino acids in the nonconserved A/B domain and lacking a three-amino acid insertion between the two zinc fingers of the C domain. Expression of rtMR mRNA (sum of both forms), measured in juvenile trout by real-time RT-PCR, shows that the transcripts are ubiquitous. Expression was significantly higher in brain than the other tissues studied (eye, trunk kidney, head kidney, gut, gills, liver, spleen, ovary, heart, white muscle, skin). Hormonal stimulation of receptor transactivation activity was studied in COS-7 cells transiently cotransfected with receptor cDNA and a mouse mammary tumor virus-luciferase reporter. The mineralocorticoids 11-deoxycorticosterone and aldosterone were more potent enhancers of rtMRa transcriptional activity (EC50 = 1.6 ± 0.5 x 10–10 and 1.1 ± 0.4 x 10–10 M, respectively) than the glucocorticoids cortisol and 11-deoxycortisol (EC50 = 1.1 ± 0.3 x 10–9 and 3.7 ± 1.9 x 10–9 M, respectively). A similar response was observed in transactivation assays with rtMRb. These results are discussed in the view of reported circulating levels of corticosteroids in trout.

Introduction
??
THE CORTICOSTEROIDS, PRODUCED and secreted by the adrenal cortex, are divided into glucocorticoids and mineralocorticoids (1). Glucocorticoids have been named for their effects on glucose homeostasis but also play important regulatory roles in metabolism, development, immune function, and stress response (2). Mineralocorticoids participate in the control of hydromineral balance by regulating the retention of sodium and potassium (3). Most physiological effects of corticosteroids are mediated through corresponding nuclear receptors that act as ligand-dependent transcription factors on hormone-responsive target genes (4).

The cloning of the glucocorticoid and the mineralocorticoid receptors (GRs and MRs) in humans revealed their high degree of sequence similarity (5, 6). Furthermore, both receptors interact with the same type of palindromic consensus sequences in the regulatory regions of target genes, so-called glucocorticoid response elements (7). Despite such similarities, the GR and MR differ in agonist specificity. The MR binds corticosteroids at a higher affinity (affinity constant of 0.5–3 nM) than the GR does (affinity constant of 20–65 nM) (3, 5, 8). Whereas both the GR and MR bind gluco- and mineralocorticoids with similar affinity, mineralocorticoids are much more efficient than glucocorticoids in transcriptionally activating the MR; the reverse is true for the GR (5, 9). The plasma concentrations of cortisol are 100- to 1000-fold greater than those of aldosterone (0.1–1 nM) (10). Consequently, the MR is expected to be permanently occupied by cortisol, which contradicts the well-documented specific physiological effects of aldosterone. This apparent paradox was resolved when the enzyme 11?-hydroxysteroid dehydrogenase (11HSD) type 2 (11HSD2), which converts glucocorticoids to inactive metabolites, was discovered (11, 12). Coexpression of MR and 11HSD2 in classical mineralocorticoid target tissues, such as the tight epithelia of the kidney and intestine, is the basis for the protection of MR from glucocorticoid access, thus enabling mineralocorticoid specificity in these tissues (11, 12).

In the teleost fish, cortisol is the most abundant circulating corticosteroid and the main steroid produced by the interrenal, the piscine adrenocortical homolog (13, 14). The debate whether aldosterone exists in fish has been ongoing for a number of years (1). The current consensus is that there is no reliable evidence for aldosterone in teleosts and that the adrenocortical tissue in this group of vertebrates lacks the enzymes that accomplish the last step of aldosterone biosynthesis (13, 15). Cortisol has been shown to have both gluco- and mineralocorticoid activity in fish (16), considered as a key hormone of seawater adaptation (17, 18), and has been shown to regulate chloride cell function during freshwater adaptation (19, 20).

When Ducouret et al. (21) cloned a GR from the rainbow trout (Oncorhynchus mykiss), it was hypothesized that fish might possess only this one corticosteroid receptor (called rtGR1). However, in rainbow trout a second GR (rtGR2) has recently been isolated by cDNA cloning (22) as well as a partial cDNA sequence encoding a rainbow trout MR homolog (rtMR) (23). A similar suite of corticosteroid receptors (hbGR1, hbGR2, and hbMR) has been cloned and characterized in another teleost fish, the cichlid Haplochromis burtoni (24). The multiple corticosteroid receptors described in trout and Haplochromis are functionally distinct. The rtGR2 is transcriptionally activated in vitro by glucocorticoids at 10- to 100-fold lower concentrations than the rtGR1 (22), whereas the transactivation activity of the hbMR is enhanced by aldosterone and cortisol at lower concentrations (EC50 of 5 and 2 x 10–10 M, respectively) than either hbGR1 and hbGR2 (EC50s for cortisol of 3.6 and 5.4 x 10–9 M, respectively) (24).

Recently, an 11HSD was identified and characterized in rainbow trout that resembles mammalian 11HSD2 in sequence and activity, converting cortisol to cortisone, and is expressed in ovary and Leydig cells of testis as well as heart, gills, and intestine (25). The coexpression of 11HSD and rtMR in tissues involved in osmoregulation, such as the gills and intestine, would open the possibility for ligands less abundant than cortisol being able to access and activate the rtMR, reminiscent of the way in which aldosterone specificity is conferred in mammals (11, 12).

In the present study, we identified the full coding sequence of the rtMR cDNA, investigated the distribution of the transcript among tissues, and analyzed the hormone dependency of its transcriptional activity. Interestingly, when we screened a broader range of corticosteroids for potential agonists, 11-deoxycorticosterone (DOC) was found to be equipotent to aldosterone, enhancing transcriptional activity of rtMR at the lower concentrations than other corticosteroids.

Materials and Methods
??
Isolation of the rtMR cDNA

AZAP II (Stratagene, Amsterdam, The Netherlands) trout embryo cDNA bank was screened with a probe derived from a partial rtMR cDNA isolated earlier (23). One-phage clone was isolated, containing a partial rtMR cDNA of 2981 bp (E1, Fig. 1; GenBank accession no. AY495581). To obtain the full coding sequence of the rtMR, a rainbow trout genomic DNA bank ( DASH II; Stratagene) was screened with a cDNA probe derived from E1. Two-phage clones, named G1 and G2, were isolated from the trout genomic DNA bank (Fig. 1). DNA fragments of G1 and G2 were generated and subcloned into pBluescript SK using appropriate enzymes. Subsequently fragments of both G1 and G2 that contained the entire second exon of the rtMR in which the initiation codon is found, plus intron sequence surrounding this exon, were isolated. For G1, an additional DNA fragment of about 3 kb, located upstream of the initiation codon, was isolated by PCR on the phage, using primer 1, TCTAGAGAGCTGTCGACGCGGCCGCGTAA (derived from phage), and primer 2, GGGAGCAGCTGACATTGACT (derived from insert).

FIG. 1. Cloning strategy. The rtMRa cDNA is shown at the top with noncoding (lines) and coding (box) regions. The partial cDNA rtMR-part was isolated in an earlier study (23 ). Screening a rainbow trout embryo cDNA led to the isolation of clone E1. Clones G1 and G2 were obtained after screening a trout genomic DNA bank. Dashed lines indicate the position of introns. The cDNA fragment RA was obtained by 5'RACE carried out on trout intestine total RNA. The entire ORF of rtMRa and rtMRb was amplified by RT-PCR with primers P6 and P7.

To obtain the sequence of the 5' region of the rtMR mRNA, a rapid amplification of 5' cDNA ends [5' rapid amplification of cDNA ends (RACE), Gibco (Paisley, Scotland, UK)] was carried out, using total RNA (1 μg) from trout intestine. After reverse transcription using the gene-specific primer 3, CCCCTCCAGATCCAGGGCACGTCTG, the first-strand cDNA was purified, tailed, and subjected to two rounds of PCR, using anchor primers provided (Gibco) in combination with primer 4, GGTGTTGGTTCTGGGTCAGT (first PCR), and primer 5, AGAGTAGGCTGCTGCTCTGG (second, nested PCR). Subcloning (pGEM T-easy; Promega, Charbonnières-les-Bains, France) and sequencing of the RACE product (RA, Fig. 1) revealed that the rtMR has, as the hMR, a putative first noncoding exon and that the 5' splicing site of the putative second exon is located 19 bp upstream of the initiation codon (Fig. 1). The partial rtMR gene sequences derived from G1 and G2 (Fig. 1; GenBank accession no. AY495582 and AY495583) were very similar but not identical

in sequence, suggesting the presence of two forms of the rtMR, termed rtMRa and rtMRb. The whole open reading frame (ORF) of the rtMR cDNA was amplified by RT-PCR on two trout tissues, gills for rtMRa (GenBank no. AY495584) and intestine for rtMRb (GenBank no. AY495585), using primer 6, TCATGTGCACAGAATGACG, and primer 7, TGGCATAGTAGTTAGGCCACTCCTG, and subcloned into the vector pGEM T-easy.

Identification of a pufferfish MR

To obtain information about the prevalence of MR homologs in teleosts, the predicted amino acid sequence of the rtMR was used in a translated BLAST search of the pufferfish (Fugu rupribes) genome (26). The search identified gene fragments corresponding to different nuclear receptors, including one MR homolog. The initiation codon and the second exon of a pufferfish mineralocorticoid receptor (frMR) were located to scaffold 4754, whereas exons 3–9 were located to scaffold 1567 of the Fugu genome version 2 (http://bahama.jgi-psf.org/fugu/bin/blast.fugu.cgi). The coding sequence of the frMR was derived from the genomic DNA sequence, and the presence of a corresponding message in Fugu kidney was confirmed by amplification of the entire ORF by RT-PCR using primer 8, ATGGAGACCAAAAGATACCAAAGT, and primer 9, CTCTGGTGGGTTTCGAACAG, followed by subcloning and sequencing of the obtained amplicon.

Sequence analysis

Sequence comparisons were carried out between the rtMRa and b, hbMR, and the frMR (this study) and other human (hMR, GenBank accession no. P08235; GR, 1201277A; progesterone receptor, P06401; androgen receptor, AF162704; estrogen receptor, P03372) or vertebrate steroid receptors (H. burtoni MR, AAM27890 Xenopus laevis MR U15133; rat MR P22199; rainbow trout, rtGR1 P49843, rtGR2 AY495372; H. burtoni: hbGR1 AAM27887 hbGR2 AAM27888 X. laevis GR P49844; rat GR P06536). The predicted amino acid sequences of the rtMR, frMR, and hMR were aligned using the ClustalW algorithm (BioEdit 5.0.9). Pairwise alignments, employing the Needleman-Wunsch algorithm and the EBLOSUM62 scoring matrix (http://www.ebi.ac.uk/), were used to establish the degree of amino acid identity between domains (5) of the rtMR and other receptors. Phylogenetic relationships among corticosteroid receptors were analyzed using the computer program package PHYLIP, version 3.6.a3 (27) (www.infobiogen.fr/). This involved the alignment (ClustalW) of the protein sequences of the ligand-binding domains, followed by the generation of phylogenetic trees using the neighbor-joining and bootstrap algorithms with human androgen receptor as the outgroup.

Quantitative real-time RT-PCR

Total RNA was isolated from tissues of freshwater-adapted immature female trout of an average weight of 60 g using a commercial reagent (TRI reagent; Sigma, St. Quentin Fallavier, France). One microgram of total RNA was reverse transcribed using Moloney murine leukemia virus reverse transcriptase and random hexamers (Promega). Primer 10, AGCTGGCTGGGAAACAGATGA, and primer 11, TCAGGGTGATTTGGTCCTCTATGG, used for real-time PCR of the rtMR (sum of rtMRa and rtMRb), were designed using primer3 software and generated a 93-bp product. The program parameters were adjusted to search for primers having a GC content of 50–60% and a melting temperature of 64–66 C. Regions permitted for upstream and downstream primers, respectively, were located in different exons, as defined by comparing the rtMR cDNA sequence to the pufferfish MR genomic DNA sequence (see above). The program mfold (http://www.bioinfo.rpi.edu/applications/mfold/old/dna/) was used to confirm that the template showed no secondary structures at the melting temperature of primers. Expression levels of the housekeeping gene 18S-RNA (GenBank accession no. AF308735) were used to control for differences in loading and cDNA synthesis efficiency between samples (primer 14, CGGAGGTTCGAAGACGATCA, primer 15, TCGCTAGTTGGCATCGTTTATG, generating a product of 62 bp).

Real-time PCRs were carried out using an iCycler (Bio-Rad Laboratories, Hercules, CA). Reactions were 25 μl and included 1 x SYBR Green PCR master mix (Applied Biosystems, Cortaboeuf, France), primers (400 or 200 nM for analyses of rtMR or 18S RNA, respectively), and cDNA (20 or 0.4 ng RNA equivalent for analyses of rtMR or 18S RNA, respectively). Cycling conditions were as follows: 10 min at 95 C, the 40 cycles of 15 sec at 95 C, and 40 sec at 55 C, followed by melt curve analysis. Fluorescence at 490 nm was determined during the annealing step. All reactions were run in triplicate. Controls without DNA template were included to verify the absence of cDNA contamination. To identify possible genomic contamination, further controls were included in which the template was the product of reverse transcription controls omitting reverse transcriptase. No amplification above background levels was observed in controls. Product melt curves confirmed that each PCR product had one peak. The software of the iCycler (Bio-Rad) was used to determine the threshold cycle (CT). For calibration, a cDNA pool was prepared from equal aliquots of all samples. To create standard curves, 80, 20, 5, 1.25, and 0.31 ng cDNA (RNA equivalent) of the cDNA pool were used in analyses of rtMR, whereas 5000, 1250, 312, 78, and 19.5 pg cDNA (RNA equivalent) were used in assays of 18S RNA. The efficiency of the PCR was calculated using the formula, E = 10[–1/slope], and was as follows: ErtMR = 1.86 and E18S = 2.01. rtMR mRNA expression levels relative to 18S RNA abundance were calculated with the equation: (0.4/20) x E18S[CT(18S)]/ErtMR[CT(rtMR)]. The homogeneity of variance in the data set was confirmed by the Fmax test. ANOVA, followed by the Tukey-Kramer multiple comparison test, was used to assess whether levels of rtMR mRNA expression differed significantly among tissues.

Expression vector constructs

To obtain the construct pCMrtMRa, the rtMRa cDNAs of E1 and G1 were merged, using an ApaI site 1053 bp downstream of the initiation codon and the resulting cDNA integrated into the expression vector pCMV5. In brief, the insert was excised from E1 (Fig. 1) with the restriction endonucleases EcoRI and HindIII and introduced into pCMV5 to give an intermediary construct. The 5' extremity of the rtMRa cDNA was amplified from G1 (Fig. 1) by a PCR that introduced at the same time a consensus sequence (28) at the level of the initiation codon [PfuTurbo DNA polymerase (Stratagene), primer 14, GACCATGGAGACCAAAAGATACCCAAG, primer 15, GTCCTGCTGGCTTCTTCGTC]. Using appropriate enzymes, the truncated 5' end of the insert of the intermediary pCMV5 construct was removed and the PCR-generated cDNA inserted, yielding pCMrtMRa. To compare rtMRa and rtMRb, their cDNAs were subcloned into the expression vector pcDNA3 (Invitrogen), yielding the constructs pcDNrtMRa and pcDNrtMRb. The rtMRa and rtMRb cDNAs were obtained in earlier steps (construction of pCMrtMRa; RT-PCR on trout intestine, see above). All constructs were sequenced to assure correctness.

Cell culture and transactivation assays

COS-7 cells were grown in DMEM (41966, Invitrogen, Carlsbad, CA) supplemented with 100 IU/ml penicillin, 100 μg/ml streptomycin, 2 mM glutamine, and 10% denatured fetal calf serum in a humidified atmosphere with 5% CO2. Four hours before transfection and throughout the rest of the experiment, cells were maintained in DMEM nutrient mixture F-12 Ham (D-2906, Sigma) supplemented with 100 IU/ml penicillin, 100 μg/ml streptomycin, 2 mM glutamine, 3.7 g/liter NaHCO3, and 2.5% denatured fetal calf serum that had previously been desteroided by dextran/charcoal treatment. Cells were transiently transfected by the calcium precipitation method using a commercial system (Promega). The phosphate solution, prepared for a 6-well tray, contained 5 μg of the receptor expression vector (pCMrtMRa, pcrtMRa, or pcrtMRb), 10 μg pFC31Luc (which contains the mouse mammary tumor virus promoter upstream of the luciferase gene), and 2 μg pSV? (Clontech, Palo Alto, CA) containing the gene coding for the ?-galactosidase enzyme. In certain experiments, the reporter plasmid pTAT-tkLuc that contains the tyrosine kinase promotor upstream of the luciferase gene was used instead of pFC31Luc, or the construct phMR that contains the human MR cDNA (29) was used as the receptor expression vector. Twelve hours after transfection, the medium was renewed and steroids (aldosterone, DOC, cortisol, corticosterone, 11-deoxycortisol, cortisone, and 17,20?, 21-trihydroxy-4-pregnen-3-one) added from 1000-fold concentrated stock solutions in ethanol. In some experiments, cells were treated with the antihormones spironolactone, progesterone, and RU486, alone or together with steroids. After a 36-h incubation, cell extracts were analyzed for luciferase (Promega) ?-galactosidase (30) activities.

In addition to solvent-controls (receiving ethanol instead of hormone), further control treatments consisted of cells that had been transfected omitting the receptor expression vector (replaced by empty vector). In the absence of receptor cDNA, only marginal luciferase activity was detectable in cells treated with solvent carrier, 10–6 M aldosterone, 10–6 M cortisol, 10–5 M progesterone, or 10–5 M spironolactone (data not shown). Except where stated otherwise, experiments were repeated at least three times independently, with triplicate cell cultures per treatment. Luciferase activity was corrected for well-specific transfection efficiency (as determined by ?-galactosidase activity) and then expressed as the percentage of the luciferase activity observed in cells treated with 10–6 M aldosterone. EC50s were determined by least square regression after log-logit transformation (31). Comparisons among treatments in experiments with antagonists were carried out by ANOVA followed by Dunnett’s test. The Fmax test was used to test the homogeneity of variance.

Results
??
Comparison of rtMRa and rtMRb with other nuclear receptors

The cloning strategy outlined above (Materials and Methods) isolated two forms of MR in rainbow trout, rtMRa (GenBank no. AY495584) and rtMRb (GenBank no. AY495585). The nucleotide sequence of the two MR cDNAs was similar (98.5% identity, Fig. 2), and the ORF of rtMRa cDNA encoded a protein of 1041 amino acids. The rtMRb predicted protein differed in 10 amino acids in the nonconserved A/B domain (listed in the legend of Fig. 2) and lacked a three-amino acid insertion (RKS, positions 687–689) between the two zinc fingers of the C domain. By contrast, only one pufferfish MR homolog (called frMR) was found in the pufferfish genome. The degree of amino acid identity of domains A/B, C, and E between the rtMRa and the hMR is higher than that of the rtMRa and any other human steroid receptor, confirming that the rtMRa is a MR homolog (Fig. 3). The disparity between rtMRa and hGR sequences is similar to that between rtMRa and rtGR1 or rtGR2 (data not shown).

FIG. 2. Amino acid sequence alignment of rtMRa with the MR sequences from pufferfish, Fugu rubripes (frMR), the cichlid fish H. burtoni (hbMR), and human (hMR). The rtMRb sequence is not shown for space reasons. The deduced amino acid sequence of rtMRb lacks the insertion present in the C domain of rtMRa (RKS, position 710–712) and further differs from that of rtMRa (in brackets) at the 10 following positions: 175 T (G in rtMRa); 181 M (K); 188 L (P); 205 S (A); 220 A (T); 272 H (Y); 313 R (L); 343S (L); 350 S(T); 466 I (V).

FIG. 3. Amino acid identity between selected domains (A/B, C, and E) of the rtMRa and different steroid receptors. hGRa, Human glucocorticoid receptor ; hPR, human progesterone receptor; hAR, human androgen receptor; hER, human estrogen receptor. Reported identities for the C domain do not take into account the presence of a three-amino acid insertion between the CI and CII regions in the rtMRa.

Amino acid sequences of the teleost MRs (rtMRa, rtMRb, hbMR, and frMR) along with the hMR were aligned to each other (Fig. 2). The C and E domains, responsible for DNA and ligand binding, respectively, are conserved regions of nuclear receptors and show a high degree of amino acid identity among the different MRs (Figs. 2 and 3). In the remaining nonconserved domains, the four fish MRs differ markedly from the hMR but resemble each other (Figs. 2 and 3). Phylogenetic analysis shows that the teleost MRs group together within the vertebrate MRs, which are distinct from the vertebrate GRs (Fig. 4). The cDNA sequence rtMRa, but not that of rtMRb, shows an insertion of three amino acids between the CI and CII regions, lacking in the sequence of frMR, hbMR, and hMR (Fig. 2). Interestingly, both rtGR1 and rtGR2 show insertions at the same site (21, 22). For rtGR1 a splicing variant lacking the insertion has been described that is expressed in testis (32). Splicing variants with insertions between the CI and CII region have been described for the hMR and hGR but are minor in abundance (33, 34).

 FIG. 4. Phylogenetic tree comparing the amino acid sequences of the E domains of different vertebrate GRs and MRs. The human androgen receptor (hAR) is included as an outgroup. The tree was generated with the PHYLIP 3.6.a3 software using the neighbor-joining method. Figures at nodes are bootstrap proportions in percent of 100 replicates.

Hormone dependency of transactivation by the rtMRa and rtMRb

The analysis of the transactivation properties of the rtMRa and rtMRb were carried out using COS-7 cells, which possess no functional endogenous corticosteroid receptors. For this reason, COS-7 cells are often used as an expression system in the study of corticosteroid receptors, including those from fish. COS-7 cells were transiently transfected with an expression vector construct containing the receptor cDNA, together with a plasmid encoding a luciferase reporter gene under the control of the mouse mammary tumor virus promoter. This promoter contains several glucocorticoid response elements and served as a model for promoters under the regulation of corticosteroid receptors. After transfection, COS-7 cells were treated with hormones for 36 h, after which reporter gene activities were measured. Among the hormones tested, the mineralocorticoids aldosterone and DOC were most effective in enhancing rtMRa transactivation, as apparent from median effective concentrations (EC50± SE) for transcriptional activation (aldosterone, 1.6 ± 0.5 x 10–10 M; DOC, 1.1 ± 0.4 x 10–10 M) (Fig. 5). Among glucocorticoids, cortisol was the best agonist (1.1 ± 0.3 x 10–9 M), followed by 11-deoxycortisol (3.7 ± 1.9 x 10–9 M), corticosterone (1.0 ± 0.5 x 10–8 M), and dexamethasone (1.5 ± 0.6 x 10–8 M) (Fig. 5). The fish-specific corticosteroid 17,20?,21-trihydroxy-4-pregnen-3-one (20?-S) (Fig. 5) and cortisone (data not shown) were only marginally active at the highest concentration tested. The hormones DOC and cortisol were chosen to compare the sensitivity between rtMRa and rtMRb (Fig. 6). EC50 values obtained with the two receptors were very similar for DOC (rtMRa, 7.3 ± 3.2 x 10–11 M; rtMRb 1.1 ± 0.3 x 10–10 M), and cortisol (rtMRa, 4.7 ± 2.5 x 10–10 M; rtMRb 1.1 ± 0.4 x 10–9 M).

 FIG. 5. Transactivation properties of rtMRa in response to corticosteroids. COS-7 cells were transiently transfected with pCMrtMRa, reporter plasmid pFC31Luc, and internal reporter (?-galactosidase, to correct for transfection efficiency). After transfection, cells were treated (36 h) with ethanol carrier (control) or corticosteroids: aldosterone (Aldo), DOC, corticosterone (B), 11-deoxycortisol (S), cortisol (F), dexamethasone (Dex), 20?-S. Data are expressed as percent of activity with 10–6 M aldosterone and represent the average and SEM from least three independent experiments.

FIG. 6. Transactivation properties of rtMRa and rtMRb in response to cortisol (F) and DOC. For experimental details, please see legend of Fig. 5.

Effects of corticosteroid antagonists

To further characterize the rtMRa, the selectivity of antagonists was studied. The effects of corticosteroid antagonists on rtMRa transactivation activity were first studied in the absence of hormonal agonists. Unexpectedly, spironolactone and progesterone, known as antimineralocorticoids in mammalian systems, had agonist activity on the rtMRa (Fig. 7A). The rtMRa response to spironolactone was biphasic, with 10–5 M of the steroid antagonist being less effective than 10–6 M. As expected, RU486, an antiglucocorticoid and antiprogestin in mammals, did not affect rtMR transcriptional activity (Fig. 7A). In a second experiment, corticosteroid antagonists were given in combination with an optimal aldosterone concentration (10–9 M). Both spironolactone and RU486 at high concentrations (10–5 M) were antagonists of aldosterone-induced transactivation (Fig. 7B). In contrast, progesterone (10–5 M) combined with aldosterone leads to markedly higher levels of transactivation than aldosterone alone (Fig. 7B).

FIG. 7. Effects of corticosteroid antagonists [spironolactone (spir), progesterone (prog), and RU486] on rtMRa and hMR transactivation in transiently transfected COS-7 cells. For method details, see legend of Fig. 5. A, Cells transfected with rtMRa cDNA and pFC31Luc were treated with ethanol carrier (control), 10–9 M aldosterone (aldo), or indicated concentrations of corticosteroid antagonists. Data are the average and SEM from three independent experiments. Significantly different from control values. *, P < 0.05; **, P < 0.01. B, Cells transfected with rtMRa cDNA and pFC31Luc were treated with 10–9 M aldosterone, alone or in combination with indicated concentrations of corticosteroid antagonists. Data are the average and SEM from three independent experiments. Significantly different from values after treatment with aldosterone only. *, P < 0.05; **, P < 0.01. C, Cells transfected with hMR cDNA and pFC31Luc were treated with aldosterone (10–9 M) and/or indicated concentrations of progesterone. Data are the average and SD of triplicate values in a representative experiment.

Our findings with hormone antagonists are unexpected in two ways. First, the antimineralocorticoids spironolactone and progesterone were full agonists of the rtMRa in the absence of aldosterone. Second, the high reporter activity observed in rtMRa-transfected cells treated with a combination of aldosterone and 10–5 M progesterone is in conflict with one fundamental assumption of cotransfection transactivation assays, i.e. that a maximum response is definable. To aid the interpretation of these unexpected results, further experiments were carried out.

First, experiments were conducted with an alternative reporter construct in which the tyrosine kinase promotor controls luciferase expression (pTAT-tkLuc). This resulted in a very similar response pattern (data not shown), confirming that the original observation was not promoter specific (34). Second, when the cDNA of the hMR was transfected into COS-7 cells together with pFC31Luc, spironolactone had no agonist activity with the hMR (data not shown) and progesterone up to 10–6 M behaved as expected (Fig. 7C). This demonstrates that the agonist activity of spironolactone and progesterone on the rtMRa (Fig. 7A) reflects the properties of the rtMRa and is not due to the experimental system. However, at a high concentration of 10–5 M, progesterone was able to maximally increase transactivation by the hMR when given alone and failed to antagonize aldosterone (Fig. 7C). This suggests that progesterone, at high concentrations, interacts with unknown factor(s) in the cellular system affecting the level of reporter activity in the presence of rtMRa or hMR.

Pattern of tissue distribution of rtMR

We investigated the mRNA expression levels of the trout MRs among tissues using quantitative real-time RT-PCR. Because of the high degree of nucleotide identity between rtMRa and rtMRb (<98.5%), these primers do not distinguish between the two forms. rtMR expression was found in all of the trout tissues investigated (brain, eye, gut, liver, kidney, gills, spleen, head kidney, ovary, heart, muscle, skin) (Fig. 8). Expression in brain was significantly higher than that in other tissues (Fig. 8).

FIG. 8. Expression of rtMR mRNA within body tissues. Quantitative real-time RT-PCR was performed on tissues from three juvenile female freshwater-adapted rainbow trout. BR, Brain; EY, eye; GU, gut; LI, liver; KI, trunk kidney; GI, gills; SP, spleen; HK, head kidney; OV, ovary; HE, heart; MU, white muscle; SK, skin. Expression of rtMR is expressed relative to that of 18S RNA. Data are plotted as averages, with SEM designated by error bars. Expression levels are significantly different (P < 0.05) between tissues when columns carry different letters.

Discussion

In the present study, we have described two MR homologs from the rainbow trout, called rtMRa and rtMRb. These two receptors show a very high sequence similarity. Their deduced amino acid sequences differ, only marginally, in the nonconserved A/B domain. Our search of the pufferfish genome identified only one MR homolog. This suggests that the duplication of trout MRs may not be a characteristic of all teleosts but specific to trout. Because of their high similarity (99% for both nucleotide and amino acid sequences), rtMRa and rtMRb most probably represent allelic variants of the same gene. Alternatively, they might represent paralogs, possibly reflecting the tetraploid ancestry of salmonids (35).

The rtMR mRNA (sum of rtMRa and rtMRb) could be detected measured by real-time RT-PCR in all tissues studied, with highest expression levels in brain and a less pronounced expression in the remaining tissues (Fig. 7). This expression pattern differs from the distribution of hMR mRNA, analyzed in Northern blots (5). Among human tissues, kidney showed the highest hMR mRNA expression, followed by brain (5). The hMR message was further detectable in gut, pituitary, and heart but not found in liver and muscle (5). The unspectacular level of rtMR expression in tissues involved in teleost osmoregulation, such as gills and intestine, is unusual for a receptor suspected to be involved in regulating ion homeostasis. However, it is conceivable that rtMR in the gill and intestine is restricted to certain cell types specifically involved in ion transport. The rtMR might adopt distinct roles in tissues not involved in osmoregulation, and the high expression levels in the brain are reminiscent of the expression pattern of the hMR (5). At present, the function of the rtMR remains unresolved, and further research, particularly concerning the cell-type-specific expression of rtMR and trout GRs, is necessary to unravel the physiological role of the rtMR.

Apart from cortisone and 20?-S, all corticosteroids tested (aldosterone, DOC, cortisol, 11-deoxycortisol, corticosterone, and dexamethasone) enhanced transcriptional activity of the rtMR in vitro. Remarkably, however, the mineralocorticoids aldosterone and DOC stimulated rtMR transactivation at 10-fold lower concentrations (EC50 of 1 x 10–10 M) than the most active glucocorticoid, cortisol. The rtMR’s preference of mineralocorticoids over glucocorticoids is reminiscent of the hMR, which, in transactivation assays, is approximately 100-fold more sensitive to DOC and aldosterone than cortisol (9). Surprisingly, the mammalian antimineralocorticoids, spironolactone and progesterone, acted as rtMR agonists. The reason for this is unclear.

Among the corticosteroids tested, cortisol is the main product of the teleost interrenal. In unstressed individuals, plasma concentrations of cortisol are less than 5 ng/ml (<14 nM), whereas 10- to 100-fold increases have been reported after stressful experiences (36). 11-Deoxycortisol, DOC, and corticosterone occur as circulating hormones in teleosts at concentrations similar to resting levels of cortisol (14, 37, 38). In rainbow trout, published plasma levels during spermiation and oocyte maturation are 14–52 nM for 11-deoxycortisol and 6.1–9.4 nM for DOC, whereas no corticosterone was found (38). Evidence for aldosterone in teleosts is unconvincing and controversial (13), and in most teleosts aldosterone is not produced by interrenal tissue in vitro (39, 40). In accordance with this, recent studies failed to provide evidence for aldosterone synthetase in teleosts (15, 41).

Cortisol, the proposed main gluco- and mineralocorticoid in teleosts, is an obvious candidate ligand for the rtMR. Cortisol has been shown to bind with high affinity to the rtMR’s ligand-binding domain (23). In the present study, cortisol enhanced transcriptional activity of the rtMRa and rtMRb (EC50 1 x 10–9 M) at lower concentrations than those required to increase transactivation by the rtGR1 (EC50 1 x 10–7 M) or rtGR2 (EC50 1 x 10–8 M) when expressed in COS-7 cells (22). Similarly, the recently described MR homolog from H. burtoni was markedly more sensitive to cortisol (EC50 2 x 10–11 M) than the two hbGRs (24). This suggests the rtMR could function as a high-affinity cortisol receptor, paralleling the role of the mammalian MR in nonclassical mineralocorticoid target tissues, such as the brain, in which it is a high-affinity (type 1) glucocorticoid receptor (42).

However, in the view of our finding that the mineralocorticoid DOC is the most potent agonist of the rtMR, the question arises whether this hormone could constitute a further physiological ligand of the rtMR. In mammals, the interaction of aldosterone with the MR in classical mineralocorticoid target tissues requires factors preventing the more abundant ligand cortisol accessing this receptor. In the plasma corticosteroid binding globulin tightly binds cortisol, 11-deoxycortisol, and DOC but not aldosterone (43), and in the mineralocorticoid target cells, the enzyme 11HSD2 metabolizes glucocorticoids to inactive products, conferring mineralocorticoid specificity (11, 12). In teleosts, evidence for corticosteroid binding globulin is lacking (41), but recently a trout 11?HSD resembling the mammalian 11?HSD2 in sequence and activity, converting cortisol to cortisone, has been cloned (25). An important function of this enzyme in fish is the biosynthesis of the active androgen, 11-ketotestosterone (44), and it was suggested that trout 11HSD might also protect gonadal tissues against adverse effects of cortisol (25). A further role of trout 11HSD might be to prevent cortisol occupancy of the rtMR, particularly in stressed fish enabling less abundant 11-deoxycorticosteroids, such as DOC, to access the receptor. Interestingly, transactivation activity of the rtMR was stimulated by two 11-deoxycorticosteroids, the most potent agonist DOC (EC50 1.1 x 10–10 M) and the moderately potent compound 11-deoxycortisol (EC50 3.7 x 10–9 M). These corticosteroids are specific rtMR agonists in that they are inactive (DOC), or only marginally active (11-deoxycortisol), on the rtGR1 and rtGR2 (22). DOC and 11-deoxycortisol are produced by teleost adrenal and ovary tissue from exogenous precursors in vitro (40, 45) and occur as circulating hormones in teleosts (37, 38).

In this study, DOC effected half-maximal transcriptional activation at approximately 1 x 10–10 M and full activation at 10-fold higher concentrations. DOC plasma levels measured in mature adult trout (5–10 nM; see above) and hence compare well to the concentration range over which the rtMR becomes transcriptionally active. Although scanty, several studies have suggested physiological effects of DOC in teleost fish. DOC induces the in vitro maturation of Heteropneustes fossilis oocytes (46) and has effects on the histology of the thymus in Oryzias latipes (47). Circulating plasma levels of DOC in tilapia increase dramatically (38-fold) during the adaptation to warm water temperatures, which coincides with the initiation of reproductive processes (48). On the basis of our results, a possible role of 11-deoxycortisol as a physiological ligand of the rtMR cannot be excluded but appears less probable in the view of the lesser activity of this steroid. Evidence for physiological effects of 11-deoxycortisol are scarcer than for DOC. A potential role of 11-deoxycortisol in the induction of oocyte maturation in sturgeon has been suggested (49).

In conclusion, the rtMR differs from the rtGRs in its the transactivational properties, indicating it is likely to be functionally distinct. Relating the agonist potential of different corticosteroids to their circulatory concentrations in trout suggests that, in addition to the major circulating teleost corticosteroid cortisol, the most potent agonist DOC, and possibly other11-deoxycorticosteroids, could act as physiological ligand(s) of the rtMR. The recent discovery of a trout 11HSD suggests that one role of this enzyme might be to inactivate cortisol, a hormone that reaches high concentrations after stressful stimuli. Action of 11HSD could provide a potential mechanism of preventing cortisol accessing the rtMR, thereby enabling the less abundant DOC to act as a ligand of the rtMR.

Acknowledgments

We thank H. Richard-Foy and F. Gouilleux for providing the plasmid pFC31Luc and Michel Pons [Institut National de la Santé et de la Recherche Médicale (INSERM) U450, Montpellier, France] for providing the plasmid pTAT-tkLuc.

References

Sandor T, Fazekas AG, Robinson BH 1976 The biosynthesis of corticosteroids throughout the vertebrates. In: Chester-Jones I, Henderson IW, eds. General, comparative and clinical endocrinology of the adrenal cortex. London: Academic Press; 25–142

Yudt MR, Cidlowski JA 2002 The glucocorticoid receptor: coding a diversity of proteins and responses through a single gene. Mol Endocrinol 16:1719–1726

Johnson JP 1992 Cellular mechanisms of action of mineralocorticoid hormones. Pharmacol Ther 53:1–29

Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895

Arriza JL, Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE, Evans RM 1987 Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237:268–275

Hollenberg SM, Weinberger C, Ong ES, Cerelli G, Oro A 1985 Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature 318:635–641

Truss M, Beato M 1993 Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocr Rev 14:459–479

Fanestil DD, Park CS 1981 Steroid hormones and the kidney. Annu Rev Physiol 43:637–649

Hellal-Levy C, Couette B, Fagart J, Souque A, Gomez-Sanchez C, Rafestin-Oblin M-E 1999 Specific hydroxylations determine selective corticosteroid recognition by human glucocorticoid and mineralocorticoid receptors. FEBS Lett 464:9–13

Farman N 1999 Molecular and cellular determinants of mineralocorticoid selectivity. Curr Opin Nephrol Hypertens 8:45–51

Edwards CR, Stewart PM, Burt D, Brett L, McIntyre MA, Sutanto WS, de Kloet ER, Monder C 1988 Localisation of 11?-hydroxysteroid dehydrogenase—tissue specific protector of the mineralocorticoid receptor. Lancet 2:986–989

Funder JW, Pearce PT, Smith R, Smith AI 1988 Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242:583–585

Balment RJ, Henderson IW 1987 Secretion of endocrine glands and their relationship to osmoregulation. In: Chester-Jones I, Ingleton PM, Phillips JG, eds. Fundamentals of comparative vertebrate endocrinology. New York: Plenum Press; 413–510

Butler DG 1973 Structure and function of the adrenal gland of fishes. Am Zool 13:839–879

Jiang J, Young G, Kobayashi T, Nagahama Y 1998 Eel (Anguilla japonica) testis 11?-hydroxylase gene is expressed in interrenal tissue and its product lacks aldosterone synthetizing activity. Mol Cell Endocrinol 146:207–211

Bern HA, Madsen SS 1992 A selective survey of the endocrine system of the rainbow trout (Oncorhynchus mykiss) with emphasis on the hormonal regulation of ion balance. Aquaculture 100:237–262

Pickford GE, Pang PK, Weinstein E, Torretti J, Hendler E, Epstein FH 1970 The response of the hypophysectomized cyprinodont, Fundulus heteroclitus, to replacement therapy with cortisol: effects on blood serum and sodium-potassium activated adenosine triphosphatase in the gills, kidney, and intestinal mucosa. Gen Comp Endocrinol 14:524–534

Foskett JK, Bern HA, Machen TE, Conner M 1983 Chloride cells and the hormonal control of teleost fish osmoregulation. J Exp Biol 106:255–281

Flik G, Perry SF 1989 Cortisol stimulates whole body calcium uptake and the branchial calcium pump in freshwater rainbow trout. J Endocrinol 120:75–82

Laurent P, Perry SF 1990 Effects of cortisol on gill chloride cell morphology and ionic uptake in the freshwater trout, Salmo gairdneri. Cell Tissue Res 259:429–442

Ducouret B, Tujague M, Ashraf J, Mouchel N, Servel N, Valotaire Y, Thompson EB 1995 Cloning of a teleost fish glucocorticoid receptor shows that it contains a deoxyribonucleic acid-binding domain different from that of mammals. Endocrinology 136:3774–3783

Bury NR, Sturm A, Le Rouzic P, Lethimonier C, Ducouret B, Guigen Y, Robinson-Rechavi M, Laudet V, Prunet P 2003 Evidence for two distinct functional glucocorticoid receptors in teleost fish. J Mol Endocrinol 31:141–156

Colombe L, Fostier A, Bury N, Pakdel F, Guigen Y 2000 A mineralocorticoid-like receptor in the rainbow trout, Oncorhynchus mykiss: cloning and characterization of its steroid binding domain. Steroids 65:319–328

Greenwood AK, Butler PC, White RB, DeMarco U, Pearce D, Fernald RD 2003 Multiple corticosteroid receptors in a teleost fish: distinct sequences, expression patterns, and transcriptional activities. Endocrinology 144:4226–4236

Kusakabe M, Nakamura I, Young G 2003 11?-hydroxysteroid dehydrogenase complementary deoxyribonucleic acid in rainbow trout: cloning, sites of expression, and seasonal changes in gonads. Endocrinology 144:2534–2545

Aparicio S, Chapman J, Stupka E, Putnam N, Chia JM, Dehal P, Christoffels A, Rash S, Hoon S, Smit A, Gelpke MD, Roach J, Oh T, Ho IY, Wong M, Detter C, Verhoef F, Predki P, Tay A, Lucas S, Richardson P, Smith SF, Clark MS, Edwards YJ, Doggett N, Zharkikh A, Tavtigian SV, Pruss D, Barnstead M, Evans C, Baden H, Powell J, Glusman G, Rowen L, Hood L, Tan YH, Elgar G, Hawkins T, Venkatesh B, Rokhsar D, Brenner S 2002 Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes. Science 297:1301–1310

Felsenstein J 2002 PHYLIP (Phylogeny Inference Package), 3.6a3 ed (distributed by the author). Seattle: University of Washington, Department of Genome Sciences

Kozak M 1986 Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44:283–292

Fagart J, Wurtz JM, Souque A, Hellal-Levy C, Moras D, Rafestin-Oblin M-E 1998 Antagonism in the human mineralocorticoid receptor. EMBO J 17:3317–3325

Herbomel P, Bourachot B, Yaniv M 1984 Two distinct enhancers with different cell specificities coexist in the regulatory region of polyoma. Cell 39:653–662

Ashton WD 1972 The logit transformation with special reference to its uses in bioassay. London: Griffin

Takeo J, Hata J, Segawa C, Toyohara H, Yamashita S 1996 Fish glucocorticoid receptor with splicing variants in the DNA binding domain. FEBS Lett 389:244–248

Bloem LJ, Guo C, Pratt JH 1995 Identification of a splice variant of the rat and human mineralocorticoid receptor genes. J Steroid Biochem Mol Biol 55:159–162

Rivers C, Levy A, Hancock J, Lightman S, Norman M 1999 Insertion of an amino acid in the DNA-binding domain of the glucocorticoid receptor as a result of alternative splicing. J Clin Endocrinol Metab 84:4283–4286

Bailey GS, Poulter RT, Stockwell PA 1978 Gene duplication in tetraploid fish: model for gene silencing at unlinked duplicated loci. Proc Natl Acad Sci USA 75:5575–5579

Wendelaar Bonga SE 1997 The stress response in fish. Physiol Rev 77:591–625

Campbell CM, Walsh JM, Idler DR 1976 Steroids in the plasma of the winter flounder (Pseudopleuronectes americanus Walbaum). A seasonal study and investigation of steroid involvement in oocyte maturation. Gen Comp Endocrinol 29:14–20

Campbell CM, Fostier A, Jalabert B, Truscott B 1980 Identification and quantification of steroids in the serum of rainbow trout during spermiation and oocyte maturation. J Endocrinol 85:371–378

Balm PH, Lambert JD, Wendelaar Bonga SE 1989 Corticosteroid biosynthesis in the interrenal cells of the teleost fish, Oreochromis mossambicus. Gen Comp Endocrinol 76:53–62

Sangalang GB, Truscott B, Idler DR 1972 A comparison of steroidogenesis in vitro in two teleosts, the marine herring, Clupea, and the freshwater Atlantic salmon, Salmo. J Endocrinol 53:433–446[Medline]

Baker ME 2003 Evolution of glucocorticoid and mineralocorticoid responses: go fish. Endocrinology 144:4223–4225[Free Full Text]

Reul JM, Gesing A, Droste S, Stec IS, Weber A, Bachmann C, Bilang-Bleuel A, Holsboer F, Linthorst AC 2000 The brain mineralocorticoid receptor: greedy for ligand, mysterious in function. Eur J Pharmacol 405:235–249

Breuner CW, Orchinik M 2002 Plasma binding proteins as mediators of corticosteroid action in vertebrates. J Endocrinol 175:99–112

Kime DE 1987 The steroids. In: Chester-Jones I, Ingleton PM, Phillips JG, eds. Fundamentals of comparative vertebrate endocrinology. New York: Plenum Press; 3–56

Colombo L, Bern HA, Pieprzyk J, Johnson DW 1973 Biosynthesis of 11-deoxycorticosteroids by teleost ovaries and discussion of their possible role in oocyte maturation and ovulation. Gen Comp Endocrinol 21:168–178

Sundararaj BI, Goswami SV 1971 Effects of desoxycorticosterone and hydrocortisone singly and in various combinations on in vitro maturation of oocytes of the catfish, Heteropneustes fossilis (Bloch). Gen Comp Endocrinol 17:570–573

Ghoneum MH, Egami N, Ijiri K, Cooper EL 1986 Effect of corticosteroids on the thymus of the fish Oryzias latipes. Dev Comp Immunol 10:35–44

Katz Y, Eckstein B 1974 Changes in steroid concentration in blood of female Tilapia aurea (Teleostei, Cichlidae) during initiation of spawning. Endocrinology 95:963–967[Medline]

Webb MA, Feist GW, Trant JM, Van Eenennaam JP, Fitzpatrick MS, Schreck CB, Doroshov SI 2002 Ovarian steroidogenesis in white sturgeon (Acipenser transmontanus) during oocyte maturation and induced ovulation. Gen Comp Endocrinol 129:27–38


  
《内分泌学杂志》2005年1月第146卷第1期