From the Department of Medicine (S.A.D., M.M., T.H.T.) and the Department of Pharmacological Sciences (A.K.D.), Medical School, University of Newcastle-Upon-Tyne, Newcastle, England.
| Abstract |
|---|
| Top Abstract Introduction Methods Results Discussion References |
|---|
Abnormal erythrocyte sodium-lithium countertransport is common in a subgroup of patients with essential hypertension and a strong family history of hypertension and cardiovascular disease. We have previously shown that the abnormality in sodium-lithium countertransport is associated with tropomyosin, a cytoskeletal protein required to stabilize actin filament formation. Leukocyte trafficking events, which depend on cytoskeletal reorganization, are also altered in patients with essential hypertension with abnormal sodium-lithium countertransport. The aim of this study was to determine whether there is an abnormality in isoforms of tropomyosin that are common to erythrocytes and leukocytes. Analysis of reticulocyte RNA by reverse transcription (RT) and polymerase chain reaction (PCR) showed expression of TPMN and TPM5b isoforms of tropomyosin. No other isoforms were expressed. These isoforms were also detected in RNA from leukocytes. In patients with essential hypertension with abnormal erythrocyte sodium-lithium countertransport compared with normal control subjects, there was a higher TPMN/TPM5b ratio of protein in erythrocytes (median 3.8 [range 1.8 to 6.6] versus 2.9 [1.9 to 4.0], P<0.001) and of RNA in leukocytes (3.7 [1.7 to 8.2] versus 2.6 [1.2 to 4.3], P<0.01). Furthermore, the protein ratio of TPMN/TPM5b in erythrocytes showed significant correlation with the Vmax/Km ratio of sodium-lithium countertransport across the patient groups (r=-0.42; P<0.01). Therefore, altered tropomyosin expression may be the underlying abnormality associated with blood cell membrane changes in essential hypertension and implicates the cytoskeleton in the pathogenesis of the disease in a major subgroup of patients.
Key Words: hypertension, essential • erythrocytes • sodium-lithium countertransport • leukocytes
| Introduction |
|---|
| Top Abstract Introduction Methods Results Discussion References |
|---|
Abnormal erythrocyte sodium-lithium countertransport (Na+/Li+ CT) is a phenotypic marker of essential hypertension in patients with a strong family history of hypertension and cardiovascular disease.1,2 These patients also commonly have features of the "metabolic syndrome" such as insulin resistance, dyslipidemia, and raised body mass index, which indicate their own increased risk of cardiovascular disease. The functional relation of erythrocyte Na+/Li+ CT to the mechanism of disease has remained unclear. However, the abnormality in erythrocyte Na+/Li+ CT has been associated with a 33-kDa extrinsic membrane protein,3–5 identified as tropomyosin,6 an actin-binding protein that has a central role in the stabilization and organization of actin filaments.
Actin filaments have an important role in granule trafficking in neutrophils,7,8 a process that we have previously established to be abnormal in hypertensive patients with abnormal Na+/Li+ CT.9 This abnormality causes enhanced fusion of neutrophil intracellular granules with the cell membrane, which leads to a more rapid integrin exocytosis to the cell surface.9 Increased integrin exposure on neutrophils may contribute to vascular damage and hence increase vascular disease in this patient subgroup. Therefore an abnormality in tropomyosin may be responsible for the altered Na+/Li+ CT in erythrocytes and granule trafficking in neutrophils observed in these patients with essential hypertension.
Studies using antibodies directed against the N-terminal end of tropomyosin have suggested that 2 major isoforms, TPMN and TPM5b, are expressed in erythrocytes.10,11 Products of the TPM3 and TPM1 genes, respectively, these are proteins composed of 248 amino acids, each having high actin-binding affinities and the ability to form heterodimers.12,13 This makes them likely candidates as components of the cytoskeleton. Polymorphisms in the exonic and splicing regions of TPMN and TPM5b have not been detected (our unpublished observations). Although TPMN and TPM5b are strongly suggested as the major isoforms present in the erythrocyte cytoskeleton, the presence of other isoforms has not been excluded. In addition, there is no information available about tropomyosin expression in leukocytes, and it is not known if TPMN, TPM5b, or other isoforms are expressed similarly in erythrocytes and leukocytes, which could sustain the hypothesis of a common protein defect.
Tropomyosin isoforms commonly expressed in erythrocytes and leukocytes were identified and their expression investigated in normal control subjects and patients with essential hypertension. We show an increase in the TPMN/TPM5b tropomyosin isoform expression ratio both at the mRNA and protein levels in patients with essential hypertension with increased erythrocyte Na+/Li+ CT. The increase in protein ratio directly correlates with kinetic changes observed in the Na+/Li+ countertransporter.
| Methods |
|---|
| Top Abstract Introduction Methods Results Discussion References |
|---|
Materials
Agarose and Taq supreme were from Helena BioSciences. Bio-X-Act Taq polymerase and Opti-buffer were from Bioline. Unless stated otherwise, all other reagents were obtained from Sigma. Reagents were used according to the manufacturer’s instructions.
Patients
Blood samples for reticulocyte mRNA were obtained from 2 patients with increased reticulocyte levels caused by abnormalities that cause reduced erythrocyte life-span but do not involve any known abnormality in the membrane cytoskeleton. Patient 1 was male, with erythrocyte pyruvate kinase deficiency accompanied by hemolytic anemia. Patient 2 was female, with ß-thalassemia. Patients with essential hypertension receiving antihypertensive treatment to maintain blood pressure <140/90 mm Hg were recruited from local hypertension clinics. Secondary causes of hypertension were excluded; patients had not had previous myocardial infarction, stroke, or heart failure. However, they had either at least one other cardiovascular risk factor and abnormal Na+/Li+ CT (EHT+) or no other cardiovascular risk factors and Na+/Li+ CT within normal limits (EHT-). Erythrocyte Na+/Li+ CT was measured, and transporter kinetics were classed as normal or abnormal as previously described.5Age and gender-matched normotensive control subjects (NC) were university and hospital staff and friends and spouses of patients with blood pressure <140/90 mm Hg and normal Na+/Li+ CT. Diabetes was excluded by a fasting blood glucose <6 mmol/L, and NC had no family history of hypertension. Patient general characteristics are shown in . Blood for RNA was taken into sodium-EDTA tubes, stored on ice, and processed within 1 hour of collection. The Joint Ethics Committee of the Newcastle Health Authority and Newcastle University approved the study protocol, and all subjects gave informed consent.
|
Separation of Reticulocyte and Leukocyte Fractions
Blood was centrifuged at 400g for 10 minutes at room temperature; the buffy coat was placed in a separate tube and made up to the original blood volume by use of ice-cold diethylpyrocarbonate-treated (DEPC-treated) PBS. Erythrocyte lysis buffer (320 mmol/L sucrose, 5 mmol/L MgCl2, 1% vol/vol Triton X-100, 10 mmol/L Tris-HCl, pH 8.0) was added and centrifuged at 2000g for 10 minutes at 4°C. Residual red cells in the pellet were lysed by addition of a further 10 mL of lysis buffer, and the leukocytes were pelleted by centrifuging.
Red cells free of buffy coat were suspended in an equal volume of PBS, pelleted by centrifugation at 400g for 10 minutes at room temperature, and the supernatant and uppermost layer of cells discarded. After 5 washes, reticulocytes were free of leukocytes.
RNA Isolation, cDNA Synthesis, and Reticulocyte cDNA Purity
RNA was isolated by means of TRI-reagent BD and cDNA synthesized with the Omniscript kit (Qiagen) after first DNase-treating samples with RNase-free DNase (Promega).
Leukocyte contamination of reticulocyte cDNA was excluded by polymerase chain reaction (PCR) for a 743 base pair (bp) fragment of the HLA-DQ-
major histo-compatibility region,14 using the forward primer 5'-GCTCTGATGCTGGGGTCCC-3' and the reverse primer 5'-GGGCCCTTGGTGTCTGGAA-3'. Each 50-µL reaction contained 0.2 mmol/L deoxynucleotide triphosphates (dNTPs), 0.25 µmol/l primers, 1.5 U Taq supreme DNA polymerase, and 2 µL template cDNA. Samples were denatured for 5 minutes at 95°C, followed by 40 cycles of 95°C 1 min/60°C 1 min/68°C 1 minute and a final extension at 68°C for 7 minutes in a Gene-Amp thermocycler (PE Applied Biosystems). Samples were electrophoresed in agarose gels and visualized by UV transillumination according to standard procedures.15
Amplification of Tropomyosin cDNA Isoforms and Sequencing
Each 50-µL PCR reaction contained 1.5 U Taq supreme DNA polymerase (68°C extension temperature) or 2 U Bio-X-Act Taq polymerase (72°C extension temperature), 0.2 mmol/L dNTPs, 0.25 µmol/L of both forward and reverse primers (), and 2 µL template cDNA. Reaction conditions are given in .
|
|
Amplified DNA was sequenced in an Applied Biosystems 377 Sequencer by means of the nucleotide dye-terminating method.
Tropomyosin of Erythrocyte Ghosts and Leukocyte Membranes
Erythrocytes were lysed, on ice, in lysing buffer (20 mmol/L PBS containing 4 mmol/L MgSO4, 230 µmol/L PMSF, 1 mmol/L EGTA, 1 µmol/L pepstatin, 1 µmol/L leupeptin and 2.5 mmol/L benzamidine). Membranes were collected by centrifuging at 10 000g for 10 minutes at 4°C. Leukocyte membranes were prepared as previously described.16
Membrane proteins were separated by SDS-PAGE17 and electroblotted to PVDF membrane. Immunoblotting for tropomyosin isoforms TPM5b and TPMN was performed with the monoclonal antibodies Pep3–4313 and CG3,18 respectively.
For quantification, erythrocyte membrane tropomyosin was extracted in 20 mmol/L EDTA and contaminating proteins heat denatured at 95°C for 10 minutes. Tropomyosins were separated by SDS-PAGE17 and stained in Coomassie brilliant blue. Bands were quantified using ID image-analysis software (Kodak).
Preparation of DIG-Labeled Riboprobes
Exons 5 to 9d of the TPM1 gene, exons 4 to 9d of the TPM3 gene, or a 161-bp fragment of human 28s ribosomal RNA were reverse-transcribed and amplified by PCR as described above, using the primers: forward; AAGCTGGTCATCATTGAGAGC, reverse; ATGAAAGAATGTGGTCGCAGC, or forward; CAGAAGAGGCAGATAGG AAG, reverse; ATCTCATTCAGGTCAAGCAG or forward; GATCCTTCGATGTCGG CTC, reverse; CTGAGCAGG-ATTACCATGGC respectively. T7 polymerase promoter adaptors and a MAXI-Script kit (both Ambion) were used to generate digoxigenin (DIG)-labeled RNA probes.
Denaturing Formaldehyde Electrophoresis and Northern Blot Analysis
RNA samples (2 µg) were denatured and size-fractionated by electrophoresis on agarose-formaldehyde gels, transferred to positively charged nylon membrane (Roche Diagnostics), and UV cross-linked with a Stratalinker (Stratagene), according to standard protocols.15 Transfer efficiency was assessed by staining the membrane with methylene blue.15
Membranes were hybridized at 64°C in Ultra-hyb (Ambion), using DIG-labeled riboprobes and bound probe detected with anti–DIG-alkaline phosphatase, CPD-Star substrate (both Roche Diagnostics), and exposure to enhanced chemiluminescence film (Amersham). Bands were quantified by ID image-analysis software (Kodak).
| Results |
|---|
| Top Abstract Introduction Methods Results Discussion References |
|---|
Expression of Tropomyosin Isoforms
Isoform expression was analyzed by using primers designed to human DNA sequences or to rat DNA after alignment with mouse and rabbit sequences, with the ClustalW multiple sequence alignment tool (http://www.clustalw.genome.ad.jp/) used to allow for base variability across species (). Therefore, primers for exons 9b and 9c from the TPM1 gene and exon 9c and its 3' untranslated region (UTR) from the TPM3 gene were expected to bind human cDNA if exons were expressed.
To confirm that primers designed to various cDNA sequences from the 4 known tropomyosin genes () would result in PCR product, RT-PCR was first performed with human skeletal muscle and neonatal rat brain RNA used as positive controls. With the use of primers designed to amplify common exons 4 or 5 and exons 9a, b, c, or d, alternative tropomyosin isoform expression from all 4 genes in skeletal muscle was demonstrated (results not shown), as indicated by PCR products of the correct size (). RT-PCR with primers designed to amplify rat exons 9b and 9c from the TPM1 gene and exon 9c and the 3'UTR of 9c of the TPM3 gene19 () generated PCR fragments of the correct size when rat brain cDNA was used (results not shown). Subsequent sequencing confirmed the presence of each tropomyosin isoform.
|
RT-PCR reactions repeated with RNA extracted from reticulocytes (immature erythrocytes) of patient 1 demonstrated expression of 2 tropomyosin isoforms (a, panel R). Exon 9d from both TPM1 and TPM3 was present. Leukocyte cDNA, however, suggested that at least 6 tropomyosin isoforms are expressed (a, panel L). These included splice variants that used exon 9d from TPM1 and exon 9d from TPM3. Sequencing revealed that the isoforms expressing exon 9d from the TPM1 and TPM3 genes from both reticulocytes and leukocytes also contained the alternatively spliced exon 6a but not 6b. Experiments with cDNA derived from the reticulocytes and leukocytes from patient 2 demonstrated identical expression patterns (results not shown).
|
Further RT-PCR and sequencing using primers designed to amplify exons 1a and 1b from both the TPM1 (b) and TPM3 genes (c) showed that exon 1b was used from both genes. This confirmed the identity of the isoforms expressed in reticulocytes to be TPMN and TPM5b and showed that the same 2 were also expressed in leukocytes. PCR with primers specific for the HLA-DQ gene region14 demonstrated that reticulocyte fractions were free from leukocyte contamination (results not shown). Exon structures of TPMN and TPM5b transcripts are depicted in .
|
Western Blot Analysis of TPMN and TPM5b in Erythrocytes and Leukocytes
To show that the TPMN and TPM5b proteins were present in erythrocytes and leukocytes, Western blotting and immunodetection were used. Antibodies specific to TPMN and TPM5b detected 2 immunoreactive proteins of apparent molecular weights of 33 kDa and 31 kDa, respectively, in both erythrocyte and leukocyte membrane preparations (). Both proteins are expressed and are associated with the cytoskeleton. The CG3 antibody also showed significant immunoreactivity toward a second protein of
30 kDa. It appears that this may be an alternatively spliced tropomyosin from the TPM3 gene that also contains exon 1b encoded amino acids to which the CG3 antibody was raised.18
|
TPMN and TPM5b in Erythrocytes From Patients With Essential Hypertension and Relation to Na+/Li+ CT
Heat-stable proteins of 33 and 31 kDa extracted from erythrocytes (a) were confirmed as TPM5b and TPMN by immunoblotting with the monoclonal antibodies Pep3 to 43 and CG3 (c, respectively). Analysis of the TPMN to TPM5b protein levels demonstrated a significantly greater ratio in patients with essential hypertension with abnormal erythrocyte Na+/Li+ CT than in both the NC (P<0.001) and patients with essential hypertension without abnormal Na+/Li+ CT groups (P<0.01, d). Median (range) values were 2.9 (1.9 to 4.0), 2.9 (0.9 to 4.1), and 3.8 (1.8 to 6.6) for NC, normal Na+/Li+ CT essential hypertensive (EHT-), and abnormal Na+/Li+ CT essential hypertensive groups (EHT+), respectively. The EHT+ group excluding the 6 outliers had median (range) values of 3.6 (1.8 to 4.3) and remained significantly higher than in both NC and EHT- groups (P<0.01).
|
The Vmax/Km ratio of Na+/Li+ countertransporter is increased in essential hypertension. The Vmax/Km of the Na+/Li+ countertransporter over all patient groups was correlated with the TPMN/TPM5b ratio (r=-0.42; P<0.01; e).
TPMN and TPM5b mRNA in Leukocytes From Patients With Essential Hypertension
Northern hybridization with riboprobes specific for the 28s subunit of ribosomal RNA, used as a loading control, detected message at 4.9 kb (a). Probes specific for exons 5 to 9d of the TPM5b transcript and exons 4 to 9d of the TPMN transcript detected the presence of mRNA species at 1.9 and 2.5 kb, respectively, in leukocytes (a).
|
Densitometry of bands produced from Northern blots showed an increased relative abundance of mRNA for TPMN compared with that of TPM5b in the EHT+ group compared with the NC group (P<0.01; b) with median (range) values of 3.7 (1.7 to 8.2) and 2.6 (1.2 to 4.3), respectively.
| Discussion |
|---|
| Top Abstract Introduction Methods Results Discussion References |
|---|
Two tropomyosin isoforms, TPMN and TPM5b, are expressed in both erythrocytes and leukocytes. In patients with essential hypertension with abnormal erythrocyte Na+/Li+ CT, the expression ratio of TPMN/TPM5b is increased in both erythrocytes and leukocytes when compared with NC and patients with essential hypertension without the Na+/Li+ CT abnormality.
The expression of only TPMN and TPM5b isoforms by erythrocytes may be functionally important because these nonmuscle isoforms can readily form heterodimers12,13 and not predominantly homodimers, as was initially thought.20–22 Assuming similar affinities for homodimers and heterodimers of TPMN and TPM5b, the change in isoform expression observed would on average change the occurrence of the TPM5b homodimer from 1 in 10.6 to 1 in 19.2 tropomyosin dimers and the TPMN/TPM5b heterodimer from 1 in 3.2 to 1 in 4.1 tropomyosin dimers. Although TPMN and TPM5b have similar binding affinities for filamentous actin (F-actin) and tropomodulin10,23,24 when compared with other low-molecular-weight tropomyosins, there are probably differences in their interaction with other tropomyosin-and actin-binding proteins. A model for how variations in tropomyosin isoforms can affect actin filament function has been described.25 Therefore, the functional coiled-coil dimer of tropomyosin of TPMN/TPMN and TPM5b/TPM5b homodimers and TPMN/TPM5b heterodimers may have very different functional properties. A change in relative isoform expression is likely to change the functional characteristics of the tropomyosin polymer and its interaction with actin filaments of the cytoskeleton. This is likely to have considerable functional effects on cytoskeletal actin filament assembly and function.
An effect of tropomyosin isoform expression on Na+/Li+ CT is consistent with the role of the cytoskeleton in modulating ion transport.26 In this respect, Na+/Li+ CT is similar to several other cell membrane ion transporters that are also modulated by their association with the cytoskeleton.27–31 We have previously shown the sensitivity of Na+/Li+ CT to tropomyosin influences on the cytoskeleton by the change in Na+/Li+ CT kinetics with liposome-delivered tropomyosin antibodies.6 The results further support the hypothesis that abnormal Na+/Li+ CT in the erythrocyte is a marker for abnormal tropomyosin expression in essential hypertension. Tropomyosin modulates the sodium ion-binding affinity at the outside site, which is the abnormal parameter in essential hypertension. This kinetic parameter is assessed by the Vmax/Km ratio, but the correlation between the Vmax/Km and tropomyosin isoform ratio is limited by the effect of other factors on Vmax/Km such as the number of transporters, which is likely to vary between subjects, as we have discussed previously.3,5
The change in TPMN/TPM5b expression ratio in the patients with essential hypertension is very similar at the protein level in erythrocytes and the messenger RNA level in leukocytes, suggesting that the change may be generalized among cell types. This could underlie several abnormal cell functions that are involved in the pathogenesis of insulin resistance and cardiovascular disease in the patients, since they involve the actin cytoskeleton. Demonstration of the abnormality in leukocytes is especially relevant because they have an important role in the cardiovascular complications of hypertension that are common in the subgroup of patients. Neutrophil granule trafficking, which has previously been shown to be abnormal in this group of patients,3 depends on the actin cytoskeleton.7,8,32 Actin filament remodeling is central to the response to insulin33,34 and mediates important metabolic effects such as GLUT4 translocation in adipocytes and skeletal muscle.35 Failure to form actin filaments appropriately on insulin stimulation may lead to impaired glucose uptake, as recruitment of glucose transporters to the plasma membrane is blocked.36 Defective GLUT 4 trafficking probably is a cause of human insulin resistance.37 A functional cytoskeletal actin network is also required for clearance of lipids and lipid-rich particles. It mediates cellular uptake of lipoproteins38 and disruption of the actin network by cytochalasin D prevents insulin-stimulation of cellular and heparin-releasable lipoprotein lipase (LPL) activity from cardiomyocytes.39 The organization of cell-surface heparin sulfate proteoglycans is mediated by the cytoskeleton,40 and LPL binding causes proteoglycan aggregation and colocalization with the underlying actin network.41
Interestingly, left ventricular hypertrophy also occurs in hypertensive patients, and this is particularly common in patients with abnormal Na+/Li+ CT.42 Furthermore, patients with cardiac hypertrophy associated with hypertension have also been reported to have elevated platelet tropomyosin levels, possibly TPMN from its electrophoretic mobility.43 Our results show that relative expression of TPMN/TPM5b is abnormal in a subgroup, but not all patients with essential hypertension, consistent with the multifactorial cause of this condition. Since the EHT- group, who were not different from NC, were receiving the same pharmacotherapies as the EHT+ group and had the same levels of blood pressure, it is unlikely that either factor caused a change in tropomyosin expression. It was regarded as unethical to withdraw or withhold antihypertensive therapy from the hypertensive patients. We cannot exclude a role for differences in tropomyosin isoform expression in other diseases and those in which hypertension is common and associated with abnormal Na+/Li+ CT deserve attention.
Therefore, an apparently functionless erythrocyte membrane marker has led to a protein not previously associated with blood pressure control. However, the group of patients involved have several other abnormalities associated with cardiovascular risk, and abnormal tropomyosin expression leading to cytoskeletal dysfunction could be an important factor in most of them.
Perspectives
Interest is now directed toward the upstream genomic regions of TPM1 and TPM3 that encode TPM5b and TPMN, respectively, and the transcription factors that control their expression. There may be several polymorphisms involved contributing to the complexity of essential hypertension. It can be seen that 6 patients studied had notably higher TPMN/TPM5b protein expression ratios than the remaining group, and this may represent a distinct polymorphism. Further investigation is required to understand the importance of altered tropomyosin expression in cytoskeletal stability and the consequences this may have on cellular processes. Ultimately, controlling gene expression may provide a unique and challenging therapeutic target in a subgroup of patients with essential hypertension who presently require aggressive antihypertensive therapy.
| Acknowledgments |
|---|
This work was supported by a British Heart Foundation project grant (PG/99178). The Northern Counties Kidney Research Fund supports Trevor H. Thomas. The authors thank Valerie Mott and Anne Taylor for their expert technical assistance, Dr Penelope Taylor for reticulocyte samples, and Dr Jane Armstrong for skeletal muscle cells. Thanks to Dr Constance J. Temm-Grove for the Pep3-43 antibody, which was made and characterized in David M. Helfman’s laboratory (Cold Spring Harbor, NY) and Professor Jim Lin for the CG3 antibody.
Received June 7, 2002; first decision July 23, 2002; accepted November 25, 2002.
| References |
|---|
| Top Abstract Introduction Methods Results Discussion References |
|---|
- Canessa M, Adragna N, Solomon HS. Increased sodium-lithium countertransport in red cells of patients with essential hypertension. N Engl J Med. 1980; 302: 772–776.
- Carr SJ, Thomas TH, Wilkinson R. Erythrocyte sodium-lithium countertransport in primary and renal hypertension: relation to family history. Eur J Clin Invest. 1989; 19: 101–106.
- Thomas TH, Rutherford PA, West IC, Wilkinson R. Sulphydryl group control of sodium-lithium countertransport kinetics: a membrane protein control abnormality in essential hypertension. Eur J Clin Invest. 1995; 25: 235–240.
- Thomas TH, Rutherford PA, Vareesangthip K, Wilkinson R, West IC. Erythrocyte membrane thiol proteins associated with changes in the kinetics of Na+/Li+ countertransport: a possible molecular explanation of changes in disease. Eur J Clin Inv. 1998; 28: 259–265.
- Mead P, Wilkinson R, Thomas TH. Thiol protein defect in sodium-lithium countertransport in subset of essential hypertension. Hypertension. 1999; 34: 1275–1280.
- Watkins SL, West IC, Wilkinson R, Thomas TH. Abnormal thiol reactivity of tropomyosin in essential hypertension and its association with abnormal sodium-lithium countertransport kinetics. J Hypertens. 2001; 19: 485–493.
- Bengtsson T, Dahlgren C, Stendahl O, Andersson T. Actin assembly and regulation of neutrophil function: effects of cytochalasin-B and tetracaine on chemotactic peptide-induced O2 production and degranulation. J Leukoc Biol. 1991; 49: 236–244.
- Zaslaver A, Feniger-Barish R, Ben-Baruch A. Actin filaments are involved in the regulation of trafficking of two closely related chemokine receptors, CXCR1 and CXCR2. J Immunol. 2001; 166: 1272–1284.
- Fardon NJM, Wilkinson R, Thomas TH. Rapid fusion of granules with neutrophil cell membranes in hypertensive patients may increase vascular damage. Am J Hypertens. 2001; 14: 927–933.
- Sung LA, Lin JJ. Erythrocyte tropomodulin binds to the N-terminus of hTM5, a tropomyosin isoform encoded by the gamma-tropomyosin gene. Biochem Biophys Res Commun. 1994; 201: 627–634.
- Sung LA, Gao KM, Yee LJ, Temm-Grove CJ, Helfman DM, Lin J-C, Mehrpouryan M. Tropomyosin isoform 5b is expressed in human erythrocytes: Implications of tropomodulin-TM5 or tropomodulin-TM5b complexes in the protofilament and hexagonal organization of membrane skeletons. Blood. 2000; 95: 1473–1480.
- Gimona M, Watakabe A, Helfman DM. Specificity of dimer formation in tropomyosins: influence of alternatively spliced exons on homodimer and heterodimer assembly. Proc Natl Acad Sci U.S.A. 1995; 92: 9776–9780.
- Temm-Grove CJ, Guo W, Helfman DM. Low molecular weight rat fibroblast tropomyosin 5 (TM-5): cDNA cloning, actin-binding, localization, and coiled-coil interactions. Cell Motil Cytoskeleton. 1996; 33: 223–240.
- Prati D, Rawal BD, Dang C, Capelli C, Vyas GN. DNA enzyme immunoassay of the PCR-amplified HLA-DQ alpha gene for estimating residual leukocytes in filtered blood. Clin Diagn Lab Immunol. 1995; 2: 182–185.
- Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
- Sarndahl E, Lindroth M, Bengtsson T, Fallman M, Gustavsson J, Stendahl O, Andersson T. Association of ligand-receptor complexes with actin filaments in human neutrophils: a possible regulatory role for a G-protein. J Cell Biol. 1989; 109: 2791–2799.
- Thompson S, Maddy AH. Gel electrophoresis of erythrocyte membrane proteins. In: Ellory JC, Young JD, eds. Red Cell Membranes: A Methodological Approach. London: Academic Press; 1982: 67–93.
- Lin JJ-C, Chou C-S, Lin JL-C. Monoclonal antibodies against chicken tropomyosin isoforms: production, characterization and application. Hybridoma. 1985; 4: 223–242.
- Novy RE, Jenny Li-Chun L, Lin CS, Jim Jung-Ching L. Human fibroblast tropomyosin isoforms: characterization of cDNA clones and analysis of tropomyosin isoform expression in human tissues and in normal and transformed cells. Cell Motil Cytoskeleton. 1993; 25: 267–281.
- Matsumura F, Yamashiro-Matsumura S. Purification and characterization of multiple isoforms of tropomyosin from rat cultured cells. J Biol Chem. 1985; 260: 13851–13859.
- Lin J-C, Helfman DM, Hughes SH, Chou CS. Tropomyosin isoforms in chicken embryo fibroblasts: purification, characterization, and changes in Rous sarcoma virus-transformed cells. J Cell Biol. 1985; 100: 692–703.
- Jancso A, Graceffa P. Smooth muscle tropomyosin coiled-coil dimers: subunit composition, assembly, and end-to-end interaction. J Biol Chem. 1991; 266: 5891–5897.
- Fowler VM, Bennett V. Erythrocyte membrane tropomyosin: purification and properties. J Biol Chem. 1984; 259: 5978–5989.
- Pittenger MF, Kazzaz JA, Helfman DM. Functional properties of non-muscle tropomyosin isoforms. Curr Opin Cell Biol. 1994; 6: 96–104.
- Khurana S. Role of actin cytoskeleton in regulation of ion transport: examples from epithelial cells. J Membr Biol. 2000; 178: 73–87.
- Lehman W, Hatch V, Korman V, Rosol M, Thomas L, Maytum R, Geeves MA, Van Eyk JE, Tobacman LS, Craig R. Tropomyosin and actin isoforms modulate the localization of tropomyosin strands on actin filaments. J Mol Biol. 2000; 302: 593–606.
- Gomes P, Soares-da-Silva P. Dopamine-induced inhibition of Na+-K+-ATPase activity requires integrity of actin cytoskeleton in opossum kidney cells. Acta Physiol Scand. 2002; 175: 93–101.
- Kurashima K, D’Souza S, Szaszi K, Ramjeesingh R, Orlowski J, Grinstein S. The apical Na(+)/H(+) exchanger isoform NHE3 is regulated by the actin cytoskeleton. J Biol Chem. 1999; 274: 29843–29849.
- Negulyaev YA, Vedernikova EA, Maximov AV. Disruption of actin filaments increases the activity of sodium-conducting channels in human myeloid leukemia cells. Mol Biol Cell. 1996; 7: 1857–1864.
- Prat AG, Holtzman EJ, Brown D, Cunningham CC, Reisin IL, Kleyman TR, McLaughlin M, Jackson GR Jr, Lydon J, Cantiello HF. Renal epithelial protein (Apx) is an actin cytoskeleton-regulated Na+ channel. J Biol Chem. 1996; 271: 18045–18053.
- Cabantchik ZI. Erythrocyte membrane transport. Novartis Found Symp. 1999; 226: 6–16.
- Advani A, Marshall SM, Thomas T. Impaired neutrophil actin assembly causes persistent CD11b expression and reduced primary granule exocytosis in Type II diabetes. Diabetologia. 2002; 45: 719–727.
- Kanzaki M, Pessin JE. Insulin-stimulated GLUT 4 translocation in adipocytes is dependent upon cortical actin remodeling. J Biol Chem. 2001; 276: 42436–42444.
- Wang QH, Khayat Z, Kishi K, Ebina T, Klip A. The actin cytoskeleton participates in translocation of GLUT1 and GLUT4 by insulin in fat and muscle cells. Diabetes. 1998; 47: 968.Abstract.
- Tong P, Khayat ZA, Huang C, Patel N, Ueyama A, Klip A. Insulin-induced cortical actin remodeling promotes GLUT4 insertion at muscle cell membrane ruffles. J Clin Invest. 2001; 108: 371–381.
- Tsakiridis T, Vranic M, Klip A. Disassembly of the actin network inhibits insulin-dependent stimulation of glucose-transport and prevents recruitment of glucose transporters to the plasma-membrane. J Biol Chem. 1994; 269: 29934–29942.
- Garvey WT, Maianu L, Zhu JH, Brechtel-Hook G, Wallace P, Baron AD. Evidence for defects in the trafficking and translocation of GLUT4 glucose transporters in skeletal muscle as a cause of human insulin resistance. J Clin Invest. 1998; 101: 2377–2386.
- Sakr SW, Eddy RJ, Barth H, Wang FW, Greenberg S, Maxfield FR, Tabas I. The uptake and degradation of matrix-bound lipoproteins by macrophages require an intact actin cytoskeleton, Rho family GTPases, and myosin ATPase activity. J Biol Chem. 2001; 276: 37649–37658.
- Ewart HS. Severson DL. Insulin and dexamethasone stimulation of cardiac lipoprotein lipase activity involves the actin-based cytoskeleton. Biochem J. 1999; 340: 485–490.
- FernandezBorja M, Bellido D, Makiya R, David G, Olivecrona G, Reina M, Vilaro S. Actin cytoskeleton of fibroblasts organizes surface proteoglycans that bind basic fibroblast growth-factor and lipoprotein-lipase. Cell Motil Cytoskeleton. 1995; 30: 89–107.
- Martinho RG, Castel S, Urena J, FernandezBorja M, Makiya R, Olivercrona G, Reina M, Alonso A, Vilaro S. Ligand binding to heparan sulfate proteoglycans induces their aggregation and distribution along actin cytoskeleton. Mol Biol Cell. 1996; 7: 1771–1788.
- Yap L, Arrazola A, Soria F, Diez J. Is there increased cardiovascular risk in essential hypertensive patients with abnormal kinetics of red blood cell sodium-lithium countertransport? J Hypertens. 1989; 7: 667–673.
- Crabos M, Yamakado T, Heizmann CW, Cerletti N, Buhler FR, Erne P. The calcium binding protein tropomyosin in human platelets and cardiac tissue elevation in hypertensive cardiac hypertrophy. Eur J Clin Invest. 1991; 21: 472–478.
Increased Prevalence of Leukocytes and Elevated Cytokine Levels in Semen from Schistosoma haematobiumInfected Individuals
Levels of L-Selectin (CD62L) on Human Leukocytes in Disseminated Cryptococcosis With and Without Associated HIV-1 Infection
Interferon- and Granulocyte-Macrophage Colony-Stimulating Factor Augment the Activity of Polymorphonuclear Leukocytes against Medically Important Zygomycetes
Detection of Angiotensin II in Supernatants of Stimulated Mononuclear Leukocytes by Matrix-Assisted Laser Desorption Ionization Time-of-Flight/Time-of-Flight Mass Analysis
The Increase of Leukocytes as a New Putative Marker of Low-Grade Chronic Inflammation and Early Cardiovascular Risk in Polycystic Ovary Syndrome
Vascular leukocytes contribute to tumor vascularization
Adrenomedullin Overexpression to Inhibit Cuff-Induced Arterial Intimal Formation
Angiotensinogen Gene Knockout Delays and Attenuates Cold-Induced Hypertension
Antihypertensive Treatments Obscure Familial Contributions to Blood Pressure Variation
Antioxidant-Rich Diet Relieves Hypertension and Reduces Renal Immune Infiltration in Spontaneously Hypertensive Rats
), and patients with essential hypertension with abnormal Na+/Li+ CT (•).