Center for Biologics Evaluation and Research, Food and Drug Administration
EMMES Corporation, Rockville
University of Maryland School of Medicine, Baltimore, Maryland
Saint Louis University, St. Louis, Missouri
University of Pennsylvania, Philadelphia
Sanofi Pasteur, Doylestown, Pennsylvania
Inactivated poliovirus vaccine (IPV) is believed to induce significantly lower mucosal immunity than oral poliovirus vaccine (OPV). Most of the data supporting this were generated before enhanced IPV (eIPV) was introduced. Excretion of poliovirus by OPV recipients can be used to assess intestinal immunity. We studied polymerase chain reaction amplification of viral complementary DNA from the stool of children vaccinated with either OPV alone or eIPV. Of first-time OPV recipients, 92% excreted virus after 1 week, and 81% excreted virus after 3 weeks. Prior vaccination with OPV reduced the number to 22% and shortened the duration of virus excretion (to 5% after 3 weeks). Two doses of IPV reduced the number of poliovirus-positive 1-week samples (to 76%), the duration of shedding (to 37% at 3 weeks), and the quantity of excreted virus. This suggests that IPV-vaccinated communities are partially protected from the spread of poliovirus. Further enhancement of IPV potency may lead to even higher levels of mucosal immunity.
The worldwide use of live trivalent oral poliovirus vaccine (OPV) has resulted in eradication of poliomyelitis in the United States [1] and most other countries [24]. OPV is a highly efficacious, economical, and easy-to-use vaccine, but it suffers from the fact that vaccine variants readily arise and occasionally can cause vaccine-associated paralytic poliomyelitis in both vaccine recipients and persons exposed to vaccine virus derivatives. Live virus excreted by vaccine recipients can be transmitted to contacts and may possess neurovirulence higher than that of the original attenuated poliovirus strains used in OPV. Immunocompromised individuals can be persistently infected and excrete viral variants for many months or years. These properties prompted many countries to switch either to a combination regimen consisting of an initial vaccination with inactivated poliovirus vaccine (IPV) followed by vaccination with OPV or to the exclusive use of IPV.
IPV also has properties that make it less than optimal for universal use throughout the world. In addition to its lower efficacy in countries with a tropical climate [5], it has been shown to induce incomplete immunity in the gastrointestinal tract, so that, although individuals vaccinated with IPV can be fully protected against the paralytic consequences of infection, they can be asymptomatically infected and excrete live virus. Consequently, poliovirus could cryptically circulate in communities vaccinated with IPV. Incomplete intestinal immunity limits the usefulness of IPV in emergency vaccinations intended to contain potential outbreaks and allows the potential spread of poliovirus in populations vaccinated with IPV if the virus is reintroduced after eradication is complete.
The data on the inefficiency of IPV in stimulating intestinal immunity were primarily generated with the conventional IPV proposed by Salk. In the 1980s, an enhanced IPV (eIPV) with increased potency was introduced and is currently used throughout the world. It is important to revisit this issue for the eIPV and to perform studies of poliovirus shedding after different vaccination regimens including OPV and IPV [6].
In an earlier clinical trial, the antibody responses to different vaccination strategies were studied [7]. One arm received IPV followed by 2 doses of OPV, and the second arm received 3 doses of OPV, at 2, 3, and 4 months of age. The antibody responses were similar for both vaccination schedules, and prior administration of IPV had little effect on virus excretion after the first dose of OPV.
A study of poliovirus shedding based on virus isolation from stool specimens in cell culture was recently performed [8]. One group of children received IPV followed by 2 doses of OPV, and the other group received OPV only. There was no clear effect on viral shedding attributable to 1 dose of IPV.
In the present article, we report the results of a more extensive study of vaccine virus excretion after 2 doses of IPV given before vaccination with OPV, compared with excretion in a group vaccinated with OPV only. Virus in stool was detected by a new method, developed in our laboratory, employing full-length (FL) polymerase chain reaction (PCR) amplification of poliovirus cDNA prepared directly from stool samples [9]. This amplification technique allowed us to circumvent the need to isolate virus in cell cultures from individual clinical samples. The results demonstrate that prior vaccination with 2 doses of IPV significantly reduces the number of virus shedders, the duration of virus excretion, and the titer of excreted virus.
SUBJECTS, MATERIALS, AND METHODS
Subjects, vaccines, and specimen collection.
Healthy infants were enrolled in a study to evaluate the equivalency of combined vaccination regimens in 1997 at Saint Louis University and at the University of Maryland [10]. The study was approved by the institutional review boards of the respective institutions, and informed consent was obtained from the parents of the participating subjects.
In the primary study, 527 infants were randomized equally into 4 arms. Subjects in arms A and B received the trivalent OPV Orimune (Wyeth-Lederle Vaccines and Pediatrics) at 2, 4, and 6 months of age. Subjects in arm C received the eIPV IPOL (Connaught-Pasteur Merieux) at 2 and 4 months of age, followed by OPV at 6 months of age. Subjects in arm D received IPV at 2, 4, and 6 months of age. Stool samples were obtained from study subjects at 1 week and 3 weeks after dose 1, as well as at 1 week and 3 weeks after dose 3 for subjects in arms A, B, and C who agreed to participate in the substudy (table 1). The samples were kept frozen until processing.
Viruses and plasmids.
US neurovirulence reference samples of Sabin serotypes 1, 2, and 3 (GenBank accession nos. AY184219, AY1842120, and AY184221) were used as positive controls for reverse-transcription (RT) and FL-PCR. The PVS(1)IC-O(T) plasmid that contains the Sabin 1 genome [11] was used as the standard for quantification in real-time PCR with SYBR Green staining.
Viral RNA extraction and cDNA preparation.
One gram of frozen stool was vortexed in 10 mL of Dulbecco's PBS and centrifuged for 10 min at 325 g, and the supernatants were aliquoted (1.5 mL/vial) and stored frozen at -70°C. A total of 140 L of the stool supernatant was used for isolation of RNA by use of the QIAamp Viral RNA Mini Kit (QIAGEN), in accordance with the manufacturer's protocol. The extracted RNA was eluted in a final volume of 60 L of sterile, RNase-free water.
Viral cDNA was prepared by reverse transcription of viral RNA, as described elsewhere [9]. Briefly, 10 L of RNA was added to the reaction, which contained 1 mmol/L dithiothreitol, 2.5 g/mL each primer (A7-Sabin1,3 and A7-Sabin2), 0.5 mmol/L dNTP mix, and 1× first-strand RT buffer (Life Technologies). The final volume of the reaction mix was 50 L. The mixture was heated for 5 min at 65°C and then quickly chilled on ice. SuperScript II (12 U/L) (Invitrogen) was added to the mixture and incubated at 42°C for 2 h; additional Superscript II (4 U/L) was then added, and the mixture was incubated for another 3 h at 42°C. Tubes were then held at 4°C until PCR amplification.
Full-length amplification of the OPV genome in stool samples.
The direct amplification of the full-length OPV genome in stool samples was performed by FL-PCR as described elsewhere [9, 12]. Ten microliters of cDNA was used for FL-PCR amplification of the OPV genome, using the XL-PCR kit (Perkin Elmer/ABI) and a GeneAmp 9700 thermocycler (ABI). The conditions were as follows: preincubation for 30 s at 94°C, followed by 35 cycles consisting of 15 s at 94°C and 10 min at 65°C, and then run-off incubation for 30 min at 72°C. The analysis of shedding of each separate poliovirus serotype was performed by amplification of the 5 untranslated region (UTR), with specific primers targeting variable regions at the ends of the segment and directing specific amplification of a single poliovirus genotype out of the mixture, as described elsewhere [9].
Viral cDNA quantification by use of SYBR Green real-time PCR.
The cDNA prepared directly from stool specimens was quantified with the ABI Prism 7700 sequence detection system (ABI). Duplicate cDNA samples were amplified with the QuantiTect SYBR Green PCR kit (ABI). Reactions were performed with 50-L mixtures containing 3 L of template cDNA, 25 L of 2× QuantiTect SYBR Green PCR Master Mix, and 300 nmol/L each primer (UF and UR). The primer sequences were as follows: sense primer UF, GGTGTGAAGAGCCTATTGAGCTACAT (melting temperature [Tm] = 58°C; nt 412438); and antisense primer UR, AGGAAACACGGACACCCAAAGTAGTCGGTT (Tm = 62°C; nt 565535). The primers were designed to bind conserved regions to amplify a part of the 5 UTR of all 3 poliovirus serotypes. The PCR conditions were as follows: preincubation for 2 min at 50°C and then 15 min at 95°C, followed by 40 cycles consisting of 15 s at 95°C, 15 s at 58 °C, and 1 min at 72°C.
The PVS(1)IC-O(T) plasmid containing the Sabin 1 genome [11] was used as a standard, and it was run in duplicate in every reaction. The concentration was calculated by optical density readings at 260 nm, and the plasmid was stored in aliquots of 100 ng until use. Standards of 105, 104, 103, 102, 101, and 100 plasmid copies/L were prepared by serial dilution of the plasmid stock in water and were stored at -20°C.
Statistical analysis.
Confidence intervals (CIs) for shedding rates were computed as exact binomial CIs. Pairwise comparisons of shedding rates for 2 vaccine groups or for the same group at 2 time points were made using Fisher's exact test. The magnitude of viral shedding based on copy numbers was compared using the Wilcoxon rank sum test. Statistical tests were not adjusted for multiple comparisons; however, in the 3 cases in which the primary comparisons of shedding rate for any viral type after a single dose of OPV versus OPV/OPV/OPV or IPV/IPV/OPV were statistically significant (P .05), the P values were so small that a Bonferroni correction would still result in P values <.001. Statistical computations were conducted using the software package R (version 2.0.1; available at: http://cran.r-project.org/).
RESULTS
Excretion of vaccine poliovirus.
Stool samples (n = 281) obtained from infants enrolled in studies of poliovirus vaccination regimens at Saint Louis University and at the University of Maryland [10] were analyzed. An FL-PCR protocol recently adapted for direct amplification of complete poliovirus genomic cDNA from stool samples was used [9]. The results summarized in table 2 show that all 22 samples obtained from infants who received IPV only were poliovirus negative; this demonstrates that there were no false-positive responses. However, 92% (95% CI, 80%98%) of samples obtained from children 1 week after the first dose of OPV were poliovirus positive, suggesting that the sensitivity of our approach was sufficiently high. The rate of excretion in this group diminished only slightly after 3 weeks, to 81% (95% CI, 67%91%), confirming that administration of OPV to immunologically naive children results in efficient infection of their intestinal tract that lasts for >3 weeks.
In contrast, prior vaccination with 2 doses of OPV leads to substantial reduction of virus shedding. Only 22% (95% CI, 11%38%) of children excreted virus 1 week after the third dose of OPV (P = 7.5 × 10-12), and this was further reduced to 5% (95% CI, 1%16%) of children after 3 weeks. Vaccination with 2 doses of IPV followed by 1 dose of OPV resulted in a 76% (95% CI, 61%88%) shedding rate. This is a substantial difference of 16%, relative to the result after 1 dose of OPV in the previously nonvaccinated children, but it is only marginally statistically significant (P = .08), owing to the relatively small sample sizes. Shedding in the group of children who received 2 doses of IPV followed by 1 dose of OPV was significantly (P < .001) reduced further, from 76% to 37% (95% CI, 22%54%) at week 3, consistent with acquisition of intestinal immunity after vaccination with IPV (table 2). The frequency of shedding by children who received 2 doses of IPV was also significantly (P < .001) lower than in the group that did not receive prior vaccination (37% in the IPV/IPV/OPV group vs. 81% in the OPV group at week 3).
Excretion rates by individual serotypes.
The overall excretion pattern of individual vaccine poliovirus serotypes was similar to the one described above for all serotypes together (table 3). The somewhat higher frequency of excretion of Sabin 1 in the group of children who received 2 doses of IPV followed by 1 dose of OPV (55% [95% CI, 39%70%]), compared with that in the group of children who received only 1 dose of OPV (42% [95% CI, 28%57%]), was not statistically significantly higher (P = .290). Three weeks after vaccination, excretion of Sabin 1 by children who received 2 doses of IPV followed by 1 dose of OPV was significantly reduced (P = .01), to 26% (95% CI, 13%43%).
Comparison of the excretion of different serotypes of vaccine poliovirus after different vaccination schedules (figure 1 and table 3) showed that the Sabin 2 strain was shed at the highest rate: 88% (95% CI, 75%95%) at week 1 and 58% (95% CI, 43%72%) at week 3 after the first OPV dose. Interestingly, 3 doses of OPV resulted in complete prevention of Sabin 2 shedding, and none of the subjects in this study excreted it after dose 3 of OPV (figure 1 and table 3). Two doses of IPV resulted in an 2-fold reduction of excretion of all 3 serotypes of poliovirus 3 weeks after administration of OPV.
Quantitative evaluation of viral shedding, by real-time PCR.
Does prior vaccination with 2 doses of IPV only decrease the number of poliovirus-positive stool samples and diminish the time of excretion, or does it also reduce the quantity of virus in those samples that were poliovirus positive We determined the copy numbers of viral cDNA in samples obtained from the group of children who received only 1 dose of OPV and from the group of children who received 2 doses of IPV followed by 1 dose of OPV, using real-time PCR with SYBR Green fluorescent dye detection. The results of this analysis (table 4) showed that, 3 weeks after vaccination, the copy number of OPV shedding in a group of 39 children who received only 1 dose of OPV varied from 35 to 7563 copies, with a geometric mean (GM) of 627 copies (95% CI, 398987 copies). In 14 children who received 2 doses of IPV followed by 1 dose of OPV, the copy numbers varied from 4 to 1800 copies, with a GM of 155 copies (95% CI, 53456 copies). This result demonstrated that children who received 2 doses of IPV followed by 1 dose of OPV excreted lower amounts of virus than did children who received 1 dose of OPV without prior IPV vaccination (P = .02, Wilcoxon rank sum test with continuity correction).
DISCUSSION
Both IVP and live OVP produce excellent systemic immune responses that protect against paralytic poliomyelitis, but IPV has been shown to produce lower mucosal immunity than OVP [13, 14]. Therefore, subjects vaccinated with IPV can be asymptomatically infected and subsequently excrete poliovirus and, thus, contribute to its transmission in communities. Unlike IPV, OPV vaccination of newborn children results in massive shedding of poliovirus for substantial periods of time. The greatest concern about OPV shedding is the propensity of excreted virus to revert to higher neurovirulence than attenuated poliovirus and its ability to circulate in communities. The highly divergent vaccine-derived polioviruses (VDPVs) were identified as the agents capable of causing outbreaks of paralytic disease [1518]. In addition, long-term persistence of poliovirus and its excretion by immunocompromised individuals has also been described [1921] and may represent the real natural reservoir of poliovirus, the size of which is largely unknown. The rigorous global monitoring of poliovirus circulation must continue after eradication is complete and until we determine that the environment is clear of all polioviruses and that the risk of their reintroduction is negligible. Such monitoring results are needed for the development of rational posteradication vaccination strategies, which have to address whether to continue vaccination against poliovirus; if vaccinations are to continue, whether to use IPV, OPV, or a combination of these vaccines; and the best way to respond to potential reintroduction of poliovirus after eradication is complete.
Continued use of OPV in countries with no wild-type poliovirus circulation carries a risk of adverse reactions and also might continue to feed poliovirus into the environment, thus maintaining the potential for generation of VDPVs. Some countries plan to continue to use IPV at least until the situation with VDPVs is studied in more detail. However, it is generally believed that communities vaccinated with IPV could allow cryptic circulation of polioviruses, because IPV does not induce adequate intestinal immunity.
The issue of the ability of IPV to induce intestinal immunity cannot be considered to be fully settled. The easiest and most direct way to address this issue is to study the levels of shedding of attenuated poliovirus after administration of OPV with or without prior vaccination with IPV. However, no published studies have been performed with the currently used vaccine administered at the recommended vaccination schedule. The available information comes from studies that were performed with just 1 dose of IPV [7, 8], which may be insufficient to produce the desired effect. Therefore, we attempted to study this issue more systematically and compared virus shedding after prior OPV or IPV administration.
In the present study, we used a novel approach based on quantitative PCR amplification of viral cDNA directly from stool samples. Traditionally, laboratory diagnosis of acute flaccid paralysis cases and environmental monitoring have involved procedures based on poliovirus isolation in cell cultures, followed by intratypic differentiation or serotyping [22]. The use of a tissue culturebased assay requires at least 23 weeks and must be performed in a laboratory with tissue culture capabilities and appropriate biosafety procedures. Another consequence of tissue cultivation is the selection of biased viral populations and the accumulation of mutations during growth in cell cultures [2326]. Because polioviruses differ in their ability to grow in various cell cultures, virus isolation is often performed in >1 cell culture simultaneously (usually HEp-2 and RD) [22]. To avoid these complications, we developed an FL-PCR procedure for the amplification of the entire poliovirus genome directly from stool samples [9]. This amplification technique allowed us to circumvent the need to isolate virus in cell cultures from individual clinical samples. In a previous study, we found that the sensitivity of the optimized FL-PCR assay used for poliovirus amplification from stool specimens was roughly equal to that of direct virus titration but could yield results in 12 days [9]. In general, PCR-based methods tend to overestimate viral load, because, unlike tissue culture protocols, they can also detect noninfectious degraded viral materials. However, in the case of the protocol that we used in the present study, this shortcoming is largely mitigated by the fact that degraded nucleic acids cannot be amplified in the FL-PCR protocol. This made it a reliable alternative method for studying viral shedding in a large number of stool samples.
Previous studies comparing poliovirus shedding after different vaccination regimens [7, 8] have been based on conventional cell culture methods. The effect of IPV on viral shedding was assessed after just 1 dose of the vaccine, which may be insufficient for creation of adequate immunity. In our study, we used 2 doses of IPV and found that they resulted in a significant reduction of viral shedding. This reduction, however, was smaller than the reduction observed after 2 doses of OPV.
The use of serotype-specific PCR primers allowed us to analyze shedding by individual poliovirus serotype. The highest level of shedding was observed for type 2 poliovirus (88% [95% CI, 75%95%]; see table 3). This serotype also demonstrated the strongest response to prior vaccination with OPV, and its shedding was completely blocked by 2 doses of this vaccine.
The most apparent reduction of shedding was observed 3 weeks after administration of OPV (compared with that after 1 week). The reduction in the duration of shedding, as well as lower quantities of virus in stool samples, suggested that IPV produced a priming effect and that subsequent administration of OPV served as a potent booster of intestinal immunity. The results in the IPV group were clearly different from those in the group of immunologically naive children, who continued to shed poliovirus after 3 weeks at approximately the same rate as after 1 week. Previous studies performed with 1 dose of IPV did not show a clear effect on viral shedding [7, 8]. It will be important to evaluate the resistance of the intestinal tract to infection with attenuated poliovirus after a full IPV vaccination regimen that includes 4 doses of IPV given at 2, 4, and 618 months of age and a final dose at 46 years of age [27]. Another point that needs further investigation is the durability of immunity conferred by IPV, including intestinal immunity. However, on the basis of our results, it can be expected that communities fully vaccinated with IPV may have a significantly reduced ability to support circulation of poliovirus. Since the efficacy of IPV in tropical and moderate climates may differ, it will be important to conduct a similar study to determine whether the same conclusions apply to the majority of the developing world. Our results also imply that emergency use of OPV in communities vaccinated with IPV to "mop up" virulent poliovirus in the event of its reemergence may be significantly safer than in unvaccinated communities. In the latter case, the spread of excreted vaccine-derived strains would be much higher and could result in their own transformation into pathogenic variants. This provides additional justification for the continued use of IPV, at least until the risk of reemergence of poliovirus is eliminated.
Additional augmentation of IPV potency may lead to further improvement of its ability to induce intestinal immunity. Our results that will be published elsewhere show that addition of an adjuvant significantly increases the ability of IPV to induce both neutralizing serum antibodies and mucosal IgA. Another modification that has been proposed for IPV is the use of attenuated strains as seed viruses in the manufacture of IPV [28]. This modification is intended to reduce the risks resulting from an accidental release of infectious polioviruses from production facilities. Different immunochemical properties of the Sabin IPV [29] call for further adjustments to this product before it can be licensed. The approach described in the present article could be used for evaluation of the efficacy of the new Sabin IPV. Together, these new developments may help to create a new generation of IPV with superior protective properties.
Acknowledgment
We thank Roland Lundquist for his suggestions and critical review of this article.
References
1. Strebel PM, Sutter RW, Cochi SL, et al. Epidemiology of poliomyelitis in the United States one decade after the last reported case of indigenous wild virusassociated disease. Clin Infect Dis 1992; 14:56879. First citation in article
2. Centers for Disease Control and Prevention. Certification of poliomyelitis eradicationEuropean Region, June 2002. MMWR Morb Mortal Wkly Rep 2002; 51:5724. First citation in article
3. Centers for Disease Control and Prevention. Progress toward global eradication of poliomyelitis, 2001. MMWR Morb Mortal Wkly Rep 2002; 51:2536. First citation in article
4. Dowdle WR, De Gourville E, Kew OM, Pallansch MA, Wood DJ. Polio eradication: the OPV paradox. Rev Med Virol 2003; 13:27791. First citation in article
5. Robertson SE, Traverso HP, Drucker JA, et al. Clinical efficacy of a new, enhanced-potency, inactivated poliovirus vaccine. Lancet 1988; 1:8979. First citation in article
6. Fine PE, Oblapenko G, Sutter RW. Polio control after certification: major issues outstanding. Bull World Health Organ 2004; 82:4752. First citation in article
7. Ramsay ME, Begg NT, Gandhi J, Brown D. Antibody response and viral excretion after live polio vaccine or a combined schedule of live and inactivated polio vaccines. Pediatr Infect Dis J 1994; 13:111721. First citation in article
8. Minor PD, Dunn G, Ramsay ME, Brown D. Effect of different immunisation schedules on the excretion and reversion of oral poliovaccine strains. J Med Virol 2005; 75:15360. First citation in article
9. Laassri M, Dragunsky E, Enterline J, et al. Genomic analysis of vaccine-derived poliovirus strains in stool specimens by combination of full-length PCR and oligonucleotide microarray hybridization. J Clin Microbiol 2005; 43:288694. First citation in article
10. Rennels MB, Englund JA, Bernstein DI, et al. Diminution of the anti-polyribosylribitol phosphate response to a combined diphtheria-tetanus-acellular pertussis/Haemophilus influenzae type b vaccine by concurrent inactivated poliovirus vaccination. Pediatr Infect Dis J 2000; 19:41723. First citation in article
11. Omata T, Kohara M, Sakai Y, Kameda A, Imura N, Nomoto A. Cloned infectious complementary DNA of the poliovirus Sabin 1 genome: biochemical and biological properties of the recovered virus. Gene 1984; 32:110. First citation in article
12. Chumakov KM. PCR engineering of viral quasispecies: a new method to preserve and manipulate genetic diversity of RNA virus populations. J Virol 1996; 70:73314. First citation in article
13. Ghendon Y, Robertson SE. Interrupting the transmission of wild polioviruses with vaccines: immunological considerations. Bull World Health Organ 1994; 72:97383. First citation in article
14. Onorato IM, Modlin JF, McBean AM, Thoms ML, Losonsky GA, Bernier RH. Mucosal immunity induced by enhance-potency inactivated and oral polio vaccines. J Infect Dis 1991; 163:16. First citation in article
15. Centers for Disease Control and Prevention. Circulation of a type 2 vaccine-derived poliovirusEgypt, 19821993. MMWR Morb Mortal Wkly Rep 2001; 50:412, 51. First citation in article
16. Centers for Disease Control and Prevention. Acute flaccid paralysis associated with circulating vaccine-derived poliovirusPhilippines, 2001. MMWR Morb Mortal Wkly Rep 2001; 50:8745. First citation in article
17. Kew O, Morris-Glasgow V, Landaverde M, et al. Outbreak of poliomyelitis in Hispaniola associated with circulating type 1 vaccine-derived poliovirus. Science 2002; 296:3569. First citation in article
18. Rousset D, Rakoto-Andrianarivelo M, Razafindratsimandresy R, et al. Recombinant vaccine-derived poliovirus in Madagascar. Emerg Infect Dis 2003; 9:8857. First citation in article
19. Khetsuriani N, Prevots DR, Quick L, et al. Persistence of vaccine-derived polioviruses among immunodeficient persons with vaccine-associated paralytic poliomyelitis. J Infect Dis 2003; 188:184552. First citation in article
20. Martin J, Dunn G, Hull R, Patel V, Minor PD. Evolution of the Sabin strain of type 3 poliovirus in an immunodeficient patient during the entire 637-day period of virus excretion. J Virol 2000; 74:300110. First citation in article
21. Cherkasova EA, Yakovenko ML, Rezapkin GV, et al. Spread of vaccine-derived poliovirus from a paralytic case in an immunodeficient child: an insight into the natural evolution of oral polio vaccine. J Virol 2005; 79:106270. First citation in article
22. World Health Organization. Polio laboratory manual. Geneva: WHO, 2001. First citation in article
23. Cherkasova E, Laassri M, Chizhikov V, et al. Microarray analysis of evolution of RNA viruses: evidence of circulation of virulent highly divergent vaccine-derived polioviruses. Proc Natl Acad Sci USA 2003; 100:9398403. First citation in article
24. Dunn G, Begg NT, Cammack N, Minor PD. Virus excretion and mutation by infants following primary vaccination with live oral poliovaccine from two sources. J Med Virol 1990; 32:925. First citation in article
25. Kew OM, Nottay BK, Hatch MH, Nakano JH, Obijeski JF. Multiple genetic changes can occur in the oral poliovaccines upon replication in humans. J Gen Virol 1981; 56:33747. First citation in article
26. Chumakov KM, Dragunsky EM, Norwood LP, et al. Consistent selection of mutations in the 5-untranslated region of oral poliovirus vaccine upon passaging in vitro. J Med Virol 1994; 42:7985. First citation in article
27. Centers for Disease Control and Prevention. Poliovirus prevention in the United States: updated recommendations of the Advisory Committee on Immunization Practices (ACIP). MMWR Morb Mortal Wkly Rep 2000; 49. First citation in article
28. Doi Y, Abe S, Yamamoto H, et al. Progress with inactivated poliovirus vaccines derived from the Sabin strains. Dev Biol (Basel) 2001; 105:1639. First citation in article
29. Dragunsky EM, Ivanov AP, Wells VR, et al. Evaluation of immunogenicity and protective properties of inactivated poliovirus vaccines: a new surrogate method for predicting vaccine efficacy. J Infect Dis 2004; 190:140412. First citation in article
When Can We Stop Using Oral Poliovirus Vaccine
Randomized Controlled Trial of an Adjuvanted Human Papillomavirus (HPV) Type 6 L2E7 Vaccine: Infection of External Anogenital Warts with Multiple HPV Types and Failure of Therapeutic Vaccination
Poliovirus Vaccine Shedding among Persons with HIV in Abidjan, Cote d'Ivoire
Reducing the Global Burden of Congenital Rubella Syndrome: Report of the World Health Organization Steering Committee on Research Related to Measles and Rubella Vaccines and Vaccination, June 2004
A Vaccine-Preventable Infectious Disease Kills Half a Million Children Annually
Toward the Development of an Antidisease, Transmission-Blocking Intranasal Vaccine for Group A Streptococcus
High-Dose Recombinant Canarypox Vaccine Expressing HIV-1 Protein, in Seronegative Human Subjects
Cervical Coinfection with Human Papillomavirus (HPV) Types and Possible Implications for the Prevention of Cervical Cancer by HPV Vaccines
Presence of Multiple Copies of the Capsulation b Locus in Invasive Haemophilus influenzae Type b (Hib) Strains Isolated from Children with Hib Conjugate Vaccine Failure
Modulation of Vaccine-Induced Immune Responses to Hepatitis C Virus in Rhesus Macaques by Altering Priming before Adenovirus Boosting