Departments of Pediatrics and Medical Microbiology, Leiden University Medical Center, Leiden, The Netherlands
Background.
Human adenovirus (HAdV) infections are increasingly frequent complications of allogeneic stem-cell transplantation (SCT), especially in children. Only a few data on the correlation between immune recovery and the course of HAdV infection are available, and data on HAdV-specific responses are lacking.
Methods.
In a prospective study, we determined the correlation between the HAdV DNA load in plasma and lymphocyte reconstitution in 48 children after allogeneic SCT. Additionally, HAdV-specific humoral and cellular immune responses were investigated.
Results.
HAdV infection occurred in 21 patients (44%), and, in 6 of these patients, the infection progressed to viremia, as demonstrated by the presence of HAdV DNA in plasma. Low lymphocyte counts at the onset of infection were predictive of HAdV viremia. Survival of patients with HAdV viremia was associated with an increase in lymphocyte counts during the first weeks after infection. In these patients, HAdV-specific CD4+ T cell responses, as well as increases in titers of neutralizing antibody, were detected after clearance of HAdV DNA from plasma.
Conclusions.
Lymphocyte reconstitution appears to play a crucial role in clearance of HAdV viremia and survival of the host, warranting further development of therapeutic interventions aimed at improving immune recovery.
In recent years, human adenovirus (HAdV) infections have been observed with increasing frequency after allogeneic stem-cell transplantation (SCT), especially in young children, and result in high mortality when the virus disseminates [18]. Currently, 51 serotypes of HAdV have been identified, classified into 6 species (AF) [9, 10]. Species A, B, and C serotypes are most frequently isolated from immunocompromised pediatric hosts and are the major cause of HAdV-related disease [1, 9, 11]. Unfortunately, HAdV infections are usually not recognized until a late stage of disease is reached, because of nonspecific clinical symptoms of infection in an immunocompromised host. Virological-culture techniques for diagnosis are time-consuming and moderately sensitive for detection of progression to viremia [12, 13]. By use of real-time quantitative polymerase chain reaction (RQ-PCR) techniques, patients can receive diagnoses at an early stage of viremia, and the course of infection can be monitored by quantification of the HAdV DNA load in plasma [1417].
Immunological recovery after SCT is of great importance for clearance of viral infections, as has been shown for other viral reactivations, such as cytomegalovirus (CMV) and Epstein-Barr virus (EBV) reactivations [1824]. So far, only a few data on the correlation between lymphocyte recovery and HAdV infection are available [25], and no data on HAdV-specific cellular and humoral immune reconstitution in relation to the course of HAdV infection in SCT recipients have been published. Better understanding of the role that immune recovery plays in adenovirus infections might be relevant for improvement of therapeutic options, because treatment with ribavirin or cidofovir is not unequivocally effective [2632].
We conducted a prospective study in which all pediatric allogeneic SCT recipients who received transplantations between 2001 and 2003 were monitored weekly for HAdV infection by culture of feces, throat-swab, and urine samples, as well as by RQ-PCR analysis of plasma samples. Lymphocyte recovery and HAdV-specific T and B cell responses were investigated in HAdV-infected patients at the onset and during the course of the infection.
PATIENTS AND METHODS
Patient cohort.
In 2001 and 2002, 53 pediatric patients received an allogeneic SCT in the pediatric bone marrowtransplant unit of the Leiden University Medical Center. The present study has been approved by the local institutional review board, and all patients included in the study provided informed consent. Five patients died within 2 months after SCT as a result of transplant-related complications or relapse. Characteristics, donor types, and graft manipulations of the 48 remaining patients are summarized in table 1. Pretreatment of the graft recipient was performed in accordance with disease-specific protocols of the relevant working parties of the European Group for Blood and Marrow Transplantation. Rabbitantithymocyte globulin (ATG) (IMTIX; 10 mg/kg for 4 days) or Campath-1H (1 mg/kg for 5 days) was given to all HLA-nonidentical SCT recipients shortly before the transplantation date. Graft-versus-host disease (GvHD) prophylaxis consisted of cyclosporin A (CsA; trough level, 100200 g/L). All patients were kept in protective isolation for at least 4 weeks after SCT and received total gut decontamination. Neither systemic antibacterial nor antiviral prophylaxis was given; preemptive treatment was administered for proven (i.e., RQ-PCRbased) CMV (ganciclovir) and EBV (administration of rituximab for depletion of B cells, to prevent posttransplant lymphoproliferative disease) reactivation. For HAdV viremia, ribavirin (60 mg/kg/day; starting dose, 30 mg/kg) or cidofovir (5 mg/kg/week) was given [32]. Intravenous immunoglobulin (IVIG) substitution was given to patients with grafts from unrelated donors for 36 months after SCT.
Virological monitoring.
Patients were screened for 6 months after SCT; samples were obtained weekly during the first 812 weeks and every 24 weeks thereafter. In this cohort, retransplantation (n = 3) was considered to be an endpoint for follow-up. Feces, urine, and throat-swab samples were inoculated on human A549 cells and scored for cytopathological effect (CPE). Plasma samples were tested for the presence of HAdV DNA by RQ-PCR. DNA was extracted from plasma by standard procedures, and 10 L of DNA-containing extract was amplified by RQ-PCR by use of oligonucleotide primers described elsewhere [33]. The amplification protocol was 15 min at 95°C, followed by 50 cycles of 95°C, 55°C, and 72°C (each 30 s). To detect these amplified products, a molecular beacon (GAGCCCACCCTTCTTTATGT) with a 5 FAM label and a 3 dabcyl label was applied (Biolego) by use of an iCycler IQ system (Biorad laboratories). Sensitivity of the assay was 50250 copies/mL [34]. Quantitated HAdV5 stock was a gift from M. Havenga (Crucell, Leiden, The Netherlands).
HAdV infection was defined as 2 consecutive positive viral cultures. Likewise, HAdV viremia was defined as the presence of >1000 copies/mL HAdV DNA in 2 consecutive plasma samples. Serotype analysis of HAdV isolates was performed by virus neutralization by use of a panel of type-specific antisera (RIVM).
Viruses.
HAdV serotypes 1, 2, 5, and 11 (RIVM) were grown on human Hep2 cells. Virus was released from the cells by 2 freeze-thaw cycles and was purified by CsCl density-gradient centrifugation. Virus stocks were titrated by use of the plaque assay on 293 cells. Purified HAdV serotypes 6 and 31 were a gift from M. Havenga.
For the antibody neutralization assay, crude lysates of HAdV-infected cells (Hep2 or A549 cells) were generated as described above. The TCID50 of each lysate was determined by diluting the lysate 10-fold, from 100 to 1012, followed by addition of Hep2 or A549 cells. After 7 days, the TCID50 was calculated as the dilution at which 50% of 10 wells showed CPE.
Immunological reconstitution.
Leukocyte and lymphocyte counts were determined every 13 days during the first 2 months after SCT. Subset analysis of peripheral blood mononuclear cells (PBMCs) (i.e., CD4+ T, CD8+ T, NK, and B cells) was performed every 48 weeks, when sufficient lymphocytes were present (usually from 48 weeks after SCT onward), by flow cytometric analysis.
HAdV-specific antibodies.
To determine titers of neutralizing antibodies (NAbs), serum samples were heat inactivated for 30 min at 56°C and diluted 2-fold, from 1 : 4 to 1 : 2048, in a 96-well plate in duplicate. HAdV lysate was diluted to 100× TCID50, added to each well, and incubated for 1 h at 37°C. Hep2 or A549 cells were added, and wells were scored for CPE after 7 days of culture. The neutralizing titer was the highest serum dilution at which CPE was no longer observed. Increases in titers (>4-fold increase) of NAbs against the serotype with which the patient was infected that occurred while titers of NAbs against other serotypes remained stable were considered to be specific responses.
HAdV-specific proliferation.
Autologous irradiated stimulator PBMCs (30 Gray) were infected (MOI, 100) with the purified HAdV serotype with which the patient was infected. For uninfected patients, PBMCs were infected with the common serotype HAdV5, because HAdV-specific T cells are usually cross-reactive [35]. Infection was performed in RPMI/0.5% bovine serum albumin (Sigma-Aldrich), at 107 cells/mL, and, after 1 h, the PBMC concentration was adjusted to 106 cells/mL by use of RPMI/10% human AB serum. Stimulator cells (1 × 105 infected or uninfected [control] cells) were cocultured with 1 × 105 responder PBMCs/well for 4 days in a 96-well round-bottom plate, after which [3H]-thymidine (0.5 Ci/well; Amersham) was added for 16 h. A stimulation index >3 was considered to be a specific response. As a control, PBMCs (4 × 104 PBMCs/well) were stimulated for 4 days in a 96-well flat-bottom plate, with -CD3 antibodies (Janssen-Cilag BV), -CD3 plus interleukin-2 (50 IU/mL; Chiron), or 5 g/mL phytohemagglutinin (Murex).
HAdV-specific production of cytokines.
For interferon (IFN) ELISPOT, PBMCs (2 × 105 PBMCs/well) in RPMI/10% human antibody serum either were stimulated (MOI, 10) with the HAdV serotype with which the patient was infected, in a 96-well round-bottom plate, or were not stimulated (control). After 4 days, IFN- ELISPOT was performed in accordance with the manufacturer's instructions (Mabtech) [36]. A specific response was defined as >25 specific spots (spotsHAdV - spotscontrol).
For intracellular cytokine staining, cells were incubated with brefeldin A (5 g/mL; Sigma-Aldrich) for 5 h at day 5 and were stained for IFN- or tumor necrosis factor (TNF), as described elsewhere [37]. The antibodies used were CD3peridinin chlorophyll proteinCy5.5, CD4fluorescein isothiocyanate, IFN-phycoerythrin (PE) or TNF-PE (Becton Dickinson), and CD8-allophycocyanin (Beckman Coulter). Cells were analyzed by use of a FACSCalibur flow cytometer with CellQuest software (Becton Dickinson).
Statistical analysis.
Transplant-related variables and immune reconstitution were evaluated in relation to HAdV infection and viremia, by univariate analyses in binary logistic regression models, with SPSS software (version 10; SPSS). Multivariate analysis was not performed, because of small numbers of patients.
RESULTS
Incidence of HAdV infection and viremia.
HAdV infection was present in 21 (44%) of 48 patients. Detailed information on the 21 infected patients is given in table 2. Three of the 21 patients were lost to follow-up (patients 13 in table 2), because of retransplantation or transplant-related mortality. In 6 (33%; patients 1621) of the remaining 18 patients, the infection progressed to viremia, as defined by the presence of HAdV DNA in plasma. Of these patients, 3 survived the infection, 2 died of HAdV (1 after a second SCT), and 1 died of HAdV as a probable cofactor in combination with GvHD.
The Kaplan-Meier curve for infection, in correlation with the type of donor, shows that patients with grafts from matched family donors and from mismatched family donors (MMFDs), as well as patients with grafts from matched unrelated donors (MUDs), were infected with HAdV at similar frequencies (figure 1). However, only in patients with grafts from MUDs did the infection progress to viremia (data not shown).
The onset of infection in patients whose viremia status remained negative by PCR (median [range], 31 [1391] days after SCT) was not significantly different from that in patients with HAdV viremia (median [range], 22 [1242] days after SCT) (P = .129) (table 2). Plasma samples were first found to be positive by PCR at a median (range) of 26 (049) days. PCR positivity followed 13 weeks after the first positive culture in 4 patients and preceded the first positive culture by 12 weeks in 2 patients. Duration of the infection was, in some cases, prolonged, both in patients with and in those without HAdV viremia, indicating that sustained infection can occur without progression to viremia (table 2).
At the time of the first detection of HAdV DNA in plasma, clinical symptoms that could exclusively be attributed to HAdV were not observed; in patients who died of infection, severe symptoms, such as liver failure, were evident only at the end stage of the disease. All 21 infected patients were found to have HAdV-positive feces samples by culture; in 11 patients, no sample from other sites was found to be positive by culture. Four of the 5 patients who had samples from multiple sites, including urine, found to be positive by culture also had HAdV viremia, as defined by the presence of HAdV DNA in plasma (table 2).
Risk factors for HAdV infection and viremia.
Risk factors for HAdV infection were HLA-mismatched donors (1 mismatch; P = .017), serotherapy with ATG or Campath in vivo (P = .026), and melphalan in the conditioning regimen (P = .018). To determine the risk factors for viremia (PCR positivity), patients with HAdV viremia were compared with HAdV-infected patients without HAdV viremia. A graft from a MUD was a risk factor for viremia (P = .005), as was female sex of the recipient (P = .016). All other variables tested in univariate analysessuch as ex vivo manipulation of the graft (by either T cell depletion or CD34+ enrichment), underlying disease, use of CsA, occurrence of GvHD, and age of the recipientwere not significantly correlated with HAdV infection or viremia.
Immune reconstitution and course of HAdV infection.
Because delayed recovery of the immune system might be of importance for the occurrence and progression of HAdV infection, absolute leukocyte and lymphocyte counts were compared between uninfected patients, HAdV-infected patients, and patients with HAdV viremia. The time to leukocyte reconstitution (set at 1 × 109 leukocytes/L) was identical in all groups (data not shown), whereas lymphocyte reconstitution (set at 0.2 × 109 lymphocytes/L) was significantly delayed in patients who developed viremia (P = .027) (figure 2A).
Furthermore, absolute lymphocyte counts were determined at the onset of infection and during the first 30 days thereafter. Patients with HAdV viremia had lower lymphocyte counts (geometrical mean, 62 lymphocytes/L) at the onset of infection than did those without HAdV viremia (geometrical mean, 310 lymphocytes/L) (P = .025) (figure 2B). Furthermore, in the 6 patients with HAdV viremia, an increase in lymphocyte counts during the next 30 days correlated with clearance of the infection and survival of the host (geometrical mean, 926 lymphocytes/L in patients surviving HAdV viremia vs. 28 lymphocytes/L in patients who died of HAdV viremia; P = .067). Patients who died of HAdV viremia had continuously increasing HAdV DNA loads in plasma without lymphocyte recovery (figure 3A) [32], whereas, in patients surviving HAdV viremia, lymphocyte recovery coincided with a decrease in HAdV DNA load (figure 4A). All lymphocyte subsets (e.g., T, B, and NK cells) were recovered in patients surviving HAdV viremia, whereas only few lymphocytes were recovered in patients who died of HAdV viremia (figures 4B and 3B, respectively). Viral infections other than HAdV occurred in patients from both groups and were successfully treated with ganciclovir and rituximab. Of the 3 patients who survived HAdV viremia, 1 received no antiviral medication targeted at HAdV, 1 received a short course of cidofovir, and 1 received a short course of ribavirin. However, clearance of HAdV viremia coincided with increasing lymphocyte counts in all 3 patients. Moreover, inefficacy of treatment with ribavirin was documented in the 3 patients who died of HAdV viremia without lymphocyte recovery [32].
HAdV-specific immune recovery.
In patients who died of HAdV viremia, serotype-specific NAbs were present in serum before infection, in some cases even at high titers (figure 3C, patients 20 and 21). Nevertheless, infection, as well as progression to viremia, occurred in these patients. During the infection, titers gradually declined to low levels.
In patients with HAdV viremia who cleared the infection, humoral immune responses were observedtiters of serotype-specific NAbs increased 816-fold (figure 4C)whereas titers of NAbs against other serotypes remained unchanged (data not shown). Responses were observed 19 months after clearance of HAdV from the plasma. Patient 18 received treatment with rituximab because of EBV reactivation, which might explain the delayed humoral response to HAdV. The early increases in titers of NAbs shortly after SCT in patients 16 and 17 were most likely due to administration of IVIG, since titers of NAbs against other serotypes increased simultaneously (data not shown).
Since PBMCs from patients who died of HAdV viremia were not available, because of poor recovery of lymphocytes, we were unable to test for HAdV-specific T cells in these patients. In patients surviving HAdV viremia, HAdV-specific responses were observed 56 weeks after clearance of viremia in 2 patients (patients 16 and 18) and 6 months after clearance of viremia in 1 patient (patient 17) (figure 4D). Accordingly, recovery of T cells was fast in patients 16 and 18, whereas recovery of T cells was delayed in patient 17 (figure 4B). The latter observation was reflected by severely impaired responses to -CD3 stimulation in this patient before detection of HAdV-specific T cells (data not shown).
HAdV-specific T-cell responses were also investigated, at 3 and 6 months after SCT, in HAdV-infected patients without HAdV viremia and in some patients without HAdV infection (figure 5). At 3 months, responses to the infecting serotype were observed in 3 (43%) of 7 HAdV-infected patients, and 2 (33%) of 6 uninfected patients responded to HAdV5. At 6 months, the percentage of HAdV-infected patients with specific T cell responses increased to 75% (6 of 8 patients), whereas the percentage of uninfected patients with specific T cell responses remained at 33% (figure 5).
Intracellular cytokine staining after in vitro stimulation of PBMCs with HAdV revealed that most IFN- and TNF-producing cells were CD4+ T cells, both in donors and in patients (figure 6 and data not shown). These data suggest that the HAdV-specific T cells detected after clearance of infection are CD4+ T cells with a Th1-like phenotype.
DISCUSSION
In the present prospective study, 48 pediatric SCT recipients were monitored for the occurrence of HAdV infection and viremia in relation to HAdV-specific immune reconstitution. The value of detection of HAdV DNA in plasma, for the diagnosis and management of viral infectionssuch as EBV and CMV and, more recently, HAdVhas been well documented [1517, 33, 3840]. Quantification of the HAdV DNA load is essential because only persistent and increasing loads have been shown to correlate with progressive disease and, eventually, death [12, 13]. In the present study, infection occurred in 44% of patients, of whom 33% developed viremia, as documented by the presence of HAdV DNA in plasma. The risk factors identified in the present studyHLA-mismatched transplants and immunosuppression by use of ATG or Campath in vivoare likely to have an impact on lymphocyte recovery [5, 6, 25, 41]. A low lymphocyte count at the time of the first virus isolation was a strong predictor of HAdV viremia. Furthermore, increasing lymphocyte counts during the first weeks of HAdV viremia were correlated with survival of the host. In patients who died of HAdV viremia, the lack of increase in lymphocyte counts could be due to a variety of factors, such as the occurrence and treatment of GvHD or retransplantation. This strong correlation between lymphocyte recovery and clearance of HAdV viremia confirms and extends the findings of a previous study [25] and is in accordance with results obtained with respect to CMV infection [23, 24, 42].
The present study is, to our knowledge, the first in which HAdV-specific immunity was investigated longitudinally in SCT recipients with documented infection. Serotype-specific humoral immune responses were detected in patients recovering from HAdV viremia several weeks to months after clearance of viremia. In comparison, peak titers of HAdV-specific antibodies in healthy individuals were observed 24 weeks after administration of adenoviral vector for gene-therapy purposes [43]. This difference in kinetics is probably due to the slowly recovering immune system in allogeneic SCT recipients. Interestingly, the presence of preexisting, high titers of HAdV-specific NAbs in serum from 2 of 6 patients did not prevent progression to viremia. Viremia did not occur in 9 HAdV-infected patients, despite the fact that 5 patients had only low titers (32) of NAbs and 3 patients had intermediate titers (32256) of NAbs at the time of infection. Together, these results suggest that the role that preexisting NAbs (as measured in vitro) play in protection against progression to viremia may be limited. As the number of patients in the present study was small, to confirm these findings, more patients should be evaluated.
In patients who cleared HAdV viremia, predominantly HAdV-specific CD4+ T cells producing IFN- were detected weeks to months after clearance of viremia. In healthy blood-bank donors, HAdV-specific CD4+ T cells producing IFN- on HAdV stimulation in vitro have also been detected [35, 44]. In individual patients, the increase in total lymphocyte counts coincided with a decrease of HAdV DNA in plasma. As this result suggests a causal relationship, the question of why specific humoral or cellular responses were detected only at later time points remains. At this stage, we can only speculate about the reasons for this observation. The decrease in HAdV DNA load strongly suggests that a specific immune response has been initiated at the site of infection, but it might be that responses are undetectable in the circulation because the frequency of specific cells is below the limit of detection. In CMV and varicella zoster virus infections, specific CD4+ cells were also observed only after clearance of viremia in patients with symptomatic disease [45] (R. van Lier, personal communication), possibly reflecting the redistribution characteristics of CD4+ T cells after viral infection. In other viral infections, such as EBV, the presence of specific CD8+ cells at the time of clearance of viremia has recently been demonstrated by use of major histocompatibility complexantigen tetramers, making detection independent of in vitro functionality [46, 47]. Defining HAdV-specific immunodominant epitopes, as has been described by Olive et al. [48], may be instrumental in the detection of HAdV-specific T cells at earlier time points by use of tetramer technology. Another possibility is that the initial control of infection is established by other (innate) immune mechanismsfor instance, NK cellswhereas the adaptive immune response is initiated at a later time point. Further research is needed to address these questions.
Weekly RQ-PCRbased screening of plasma for HAdV during the first months after allogeneic SCT, especially in recipients of grafts from MMFDs or MUDs, identifies high-risk patients at an early stage of viremia. If viremia is accompanied by an increase in lymphocyte counts, the viral infection will most likely be controlled. When lymphocyte counts remain low, alternative measures should be taken. Since the antiviral effect of ribavirin appears to be limited and since cidofovir has not been not proven to be unequivocally effective [26, 27, 2932], other interventions aimed at improving immune reconstitution should be considered. Tapering of the immunosuppression after SCT, to improve the outcome of the infection, has been suggested [25]. However, this strategy bears a high risk of concurrent, severe GvHD, especially in a recipient of a nonHLA-identical transplantation. Adoptive immunotherapy with HAdV-specific T cells, as has been performed for EBV and CMV [4951], or infusion of donor cells that have been depleted of alloreactive T cells [52, 53] might, in the near future, be options for treatment of immunocompromised graft recipients at early stages of HAdV viremia.
Acknowledgments
We thank Jan de Jong and Menzo Havenga, for providing virus strains; Martijn Rabelink, for purification and titration of virus; Erik de Klerk, for technical advice; Els Jol and Hanny Bakker, for database support; Ronald Geskus, for statistical advice; and René van Lier, René Toes, and Nicola Annels, for critical reading of the manuscript.
References
1. Flomenberg P, Babbitt J, Drobyski WR, et al. Increasing incidence of adenovirus disease in bone marrow transplant recipients. J Infect Dis 1994; 169:77581. First citation in article
2. Childs R, Sanchez C, Engler H, et al. High incidence of adeno- and polyomavirus-induced hemorrhagic cystitis in bone marrow allotransplantation for hematological malignancy following T cell depletion and cyclosporine. Bone Marrow Transplant 1998; 22:88993. First citation in article
3. Hale GA, Heslop HE, Krance RA, et al. Adenovirus infection after pediatric bone marrow transplantation. Bone Marrow Transplant 1999; 23:27782. First citation in article
4. Howard DS, Phillips II GL, Reece DE, et al. Adenovirus infections in hematopoietic stem cell transplant recipients. Clin Infect Dis 1999; 29:1494501. First citation in article
5. Baldwin A, Kingman H, Darville M, et al. Outcome and clinical course of 100 patients with adenovirus infection following bone marrow transplantation. Bone Marrow Transplant 2000; 26:13338. First citation in article
6. Runde V, Ross S, Trenschel R, et al. Adenoviral infection after allogeneic stem cell transplantation (SCT): report on 130 patients from a single SCT unit involved in a prospective multi center surveillance study. Bone Marrow Transplant 2001; 28:517. First citation in article
7. Bruno B, Gooley T, Hackman RC, Davis C, Corey L, Boeckh M. Adenovirus infection in hematopoietic stem cell transplantation: effect of ganciclovir and impact on survival. Biol Blood Marrow Transplant 2003; 9:34152. First citation in article
8. Walls T, Shankar AG, Shingadia D. Adenovirus: an increasingly important pathogen in paediatric bone marrow transplant patients. Lancet Infect Dis 2003; 3:7986. First citation in article
9. Hierholzer J. Adenoviruses in the immunocompromised host. Clin Microbiol Rev 1992; 5:26274. First citation in article
10. De Jong JC, Wermenbol AG, Verweij-Uijterwaal MW, et al. Adenoviruses from human immunodeficiency virusinfected individuals, including two strains that represent new candidate serotypes Ad50 and Ad51 of species B1 and D, respectively. J Clin Microbiol 1999; 37:39405. First citation in article
11. Carrigan DR. Adenovirus infections in immunocompromised patients. Am J Med 1997; 102:714. First citation in article
12. Schilham MW, Claas EC, van Zaane W, et al. High levels of adenovirus DNA in serum correlate with fatal outcome of adenovirus infection in children after allogeneic stem-cell transplantation. Clin Infect Dis 2002; 35:52632. First citation in article
13. Lankester AC, van Tol MJ, Claas EC, Vossen JM, Kroes AC. Quantification of adenovirus DNA in plasma for management of infection in stem cell graft recipients. Clin Infect Dis 2002; 34:8647. First citation in article
14. Echavarria M, Forman M, van Tol MJ, Vossen JM, Charache P, Kroes AC. Prediction of severe disseminated adenovirus infection by serum PCR. Lancet 2001; 358:3845. First citation in article
15. Lion T, Baumgartinger R, Watzinger F, et al. Molecular monitoring of adenovirus in peripheral blood after allogeneic bone marrow transplantation permits early diagnosis of disseminated disease. Blood 2003; 102:111420. First citation in article
16. Leruez-Ville M, Minard V, Lacaille F, et al. Real-time blood plasma polymerase chain reaction for management of disseminated adenovirus infection. Clin Infect Dis 2004; 38:4552. First citation in article
17. Gu Z, Belzer SW, Gibson CS, Bankowski MJ, Hayden RT. Multiplexed, real-time PCR for quantitative detection of human adenovirus. J Clin Microbiol 2003; 41:463641. First citation in article
18. Hromas R, Cornetta K, Srour E, Blanke C, Broun ER. Donor leukocyte infusion as therapy of life-threatening adenoviral infections after T cell depleted bone marrow transplantation. Blood 1994; 84:168990. First citation in article
19. Chakrabarti S, Collingham KE, Fegan CD, Pillay D, Milligan DW. Adenovirus infections following haematopoietic cell transplantation: is there a role for adoptive immunotherapy Bone Marrow Transplant 2000; 26:3057. First citation in article
20. Gratama JW, van Esser JW, Lamers CH, et al. Tetramer-based quantification of cytomegalovirus (CMV)specific CD8+ T lymphocytes in T-celldepleted stem cell grafts and after transplantation may identify patients at risk for progressive CMV infection. Blood 2001; 98:135864. First citation in article
21. Chakrabarti S, Milligan DW, Pillay D, et al. Reconstitution of the Epstein-Barr virusspecific cytotoxic T-lymphocyte response following T-celldepleted myeloablative and nonmyeloablative allogeneic stem cell transplantation. Blood 2003; 102:83942. First citation in article
22. Meij P, van Esser JW, Niesters HG, et al. Impaired recovery of Epstein-Barr virus (EBV)specific CD8+ T lymphocytes after partially T-depleted allogeneic stem cell transplantation may identify patients at very high risk for progressive EBV reactivation and lymphoproliferative disease. Blood 2003; 101:42907. First citation in article
23. Hakki M, Riddell SR, Storek J, et al. Immune reconstitution to cytomegalovirus after allogeneic hematopoietic stem cell transplantation: impact of host factors, drug therapy, and subclinical reactivation. Blood 2003; 102:30607. First citation in article
24. Boeckh M, Leisenring W, Riddell SR, et al. Late cytomegalovirus disease and mortality in recipients of allogeneic hematopoietic stem cell transplants: importance of viral load and T-cell immunity. Blood 2003; 101:40714. First citation in article
25. Chakrabarti S, Mautner V, Osman H, et al. Adenovirus infections following allogeneic stem cell transplantation: incidence and outcome in relation to graft manipulation, immunosuppression, and immune recovery. Blood 2002; 100:161927. First citation in article
26. Chakrabarti S, Collingham KE, Fegan CD, Milligan DW. Fulminant adenovirus hepatitis following unrelated bone marrow transplantation: failure of intravenous ribavirin therapy. Bone Marrow Transplant 1999; 23:120911. First citation in article
27. Gavin PJ, Katz BZ. Intravenous ribavirin treatment for severe adenovirus disease in immunocompromised children. Pediatrics 2002; 110:e9. First citation in article
28. Ribaud P, Scieux C, Freymuth F, Morinet F, Gluckman E. Successful treatment of adenovirus disease with intravenous cidofovir in an unrelated stem-cell transplant recipient. Clin Infect Dis 1999; 28:6901. First citation in article
29. Bordigoni P, Carret AS, Venard V, Witz F, Le Faou A. Treatment of adenovirus infections in patients undergoing allogeneic hematopoietic stem cell transplantation. Clin Infect Dis 2001; 32:12907. First citation in article
30. Legrand F, Berrebi D, Houhou N, et al. Early diagnosis of adenovirus infection and treatment with cidofovir after bone marrow transplantation in children. Bone Marrow Transplant 2001; 27:6216. First citation in article
31. Ljungman P, Ribaud P, Eyrich M, et al. Cidofovir for adenovirus infections after allogeneic hematopoietic stem cell transplantation: a survey by the Infectious Diseases Working Party of the European Group for Blood and Marrow Transplantation. Bone Marrow Transplant 2003; 31:4816. First citation in article
32. Lankester AC, Heemskerk B, Claas EC, et al. Effect of ribavirin on plasma viral DNA load in disseminating adenovirus infection. Clin Infect Dis 2004; 38:15215. First citation in article
33. Echavarria M, Forman M, Ticehurst J, Dumler JS, Charache P. PCR method for detection of adenovirus in urine of healthy and human immunodeficiency virusinfected individuals. J Clin Microbiol 1998; 36:33236. First citation in article
34. Claas ECJ, Schilham MW, de Brouwer CS, et al. Internally controlled real-time PCR monitoring of adenovirus DNA load in serum or plasma of transplant recipients. J Clin Microbiol [in press]. First citation in article
35. Heemskerk B, Veltrop-Duits LA, van Vreeswijk T, et al. Extensive cross-reactivity of CD4+ adenovirusspecific T cells: implications for immunotherapy and gene therapy. J Virol 2003; 77:65626. First citation in article
36. van der Burg SH, Ressing ME, Kwappenberg KM, et al. Natural T-helper immunity against human papillomavirus type 16 (HPV16) E7derived peptide epitopes in patients with HPV16-positive cervical lesions: identification of 3 human leukocyte antigen class IIrestricted epitopes. Int J Cancer 2001; 91:6128. First citation in article
37. de Jong A, van der Burg SH, Kwappenberg KM, et al. Frequent detection of human papillomavirus 16 E2specific T-helper immunity in healthy subjects. Cancer Res 2002; 62:4729. First citation in article
38. Niesters HG, van Esser J, Fries E, Wolthers KC, Cornelissen J, Osterhaus AD. Development of a real-time quantitative assay for detection of Epstein-Barr virus. J Clin Microbiol 2000; 38:7125. First citation in article
39. Emery VC, Sabin CA, Cope AV, Gor D, Hassan-Walker AF, Griffiths PD. Application of viral-load kinetics to identify patients who develop cytomegalovirus disease after transplantation. Lancet 2000; 355:20326. First citation in article
40. Niesters HG. Clinical virology in real time. J Clin Virol 2002; 25(Suppl3):S312. First citation in article
41. Hoffman JA, Shah AJ, Ross LA, Kapoor N. Adenoviral infections and a prospective trial of cidofovir in pediatric hematopoietic stem cell transplantation. Biol Blood Marrow Transplant 2001; 7:38894. First citation in article
42. Gutierrez A, Munoz I, Solano C, et al. Reconstitution of lymphocyte populations and cytomegalovirus viremia or disease after allogeneic peripheral blood stem cell transplantation. J Med Virol 2003; 70:399403. First citation in article
43. Harvey BG, Hackett NR, El Sawy T, et al. Variability of human systemic humoral immune responses to adenovirus gene transfer vectors administered to different organs. J Virol 1999; 73:672942. First citation in article
44. Olive M, Eisenlohr LC, Flomenberg P. Quantitative analysis of adenovirus-specific CD4+ T-cell responses from healthy adults. Viral Immunol 2001; 14:40313. First citation in article
45. Gamadia LE, Remmerswaal EB, Weel JF, Bemelman F, Van Lier RA, ten Berge IJ. Primary immune responses to human CMV: a critical role for IFN-producing CD4+ T cells in protection against CMV disease. Blood 2003; 101:268692. First citation in article
46. Marshall NA, Howe JG, Formica R, et al. Rapid reconstitution of Epstein-Barr virusspecific T lymphocytes following allogeneic stem cell transplantation. Blood 2000; 96:281421. First citation in article
47. Smets F, Latinne D, Bazin H, et al. Ratio between Epstein-Barr viral load and antiEpstein-Barr virus specific T-cell response as a predictive marker of posttransplant lymphoproliferative disease. Transplantation 2002; 73:160310. First citation in article
48. Olive M, Eisenlohr L, Flomenberg N, Hsu S, Flomenberg P. The adenovirus capsid protein hexon contains a highly conserved human CD4+ T-cell epitope. Hum Gene Ther 2002; 13:116778. First citation in article
49. Walter EA, Greenberg PD, Gilbert MJ, et al. Reconstitution of cellular immunity against cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell clones from the donor. N Engl J Med 1995; 333:103844. First citation in article
50. Heslop HE, Rooney CM. Adoptive cellular immunotherapy for EBV lymphoproliferative disease. Immunol Rev 1997; 157:21722. First citation in article
51. Einsele H, Roosnek E, Rufer N, et al. Infusion of cytomegalovirus (CMV)specific T cells for the treatment of CMV infection not responding to antiviral chemotherapy. Blood 2002; 99:391622. First citation in article
52. Andre-Schmutz I, Le Deist F, Hacein-Bey-Abina S, et al. Immune reconstitution without graft-versus-host disease after haemopoietic stem-cell transplantation: a phase 1/2 study. Lancet 2002; 360:1307. First citation in article
53. Amrolia PJ, Muccioli-Casadei G, Yvon E, et al. Selective depletion of donor alloreactive T cells without loss of antiviral or antileukemic responses. Blood 2003; 102:22929. First citation in article
Adenovirus-Mediated Expression of ;-Adrenergic Receptor Kinase C-Terminus Reduces Intimal Hyperplasia and Luminal Stenosis of Arteriovenous Polytetrafluoroethylene Grafts in Pigs
Adenovirus-Mediated Overexpression of Diacylglycerol Kinase- Inhibits Endothelin-1–Induced Cardiomyocyte Hypertrophy
Adenovirus-Mediated Transfer of Human Placental Ectonucleoside Triphosphate Diphosphohydrolase to Vascular Smooth Muscle Cells Suppresses Platelet Aggregation In Vitro and Arterial Thrombus Formation
Adenovirus-Mediated Gene Transfer of Heparin-Binding Epidermal Growth Factor-Like Growth Factor Enhances Neurogenesis and Angiogenesis After Focal Cerebral Ischemia in Rats
Modulation of Vaccine-Induced Immune Responses to Hepatitis C Virus in Rhesus Macaques by Altering Priming before Adenovirus Boosting
Ether Lipid-Ester Prodrugs of Acyclic Nucleoside Phosphonates: Activity against Adenovirus Replication In Vitro
Adenovirus DNA in Serum of Children Hospitalized Due to an Acute Respiratory Adenovirus Infection
Adenovirus-Mediated Small-Interference RNA for In Vivo Silencing of Angiotensin AT1a Receptors in Mouse Brain
Adenovirus-Mediated Overexpression of O-GlcNAcase Improves Contractile Function in the Diabetic Heart
Adenovirus Vector E4 Gene Regulates Connexin 40 and 43 Expression in Endothelial Cells via PKA and PI3K Signal Pathways